RchiOBHm_Chr5g0001191

tRNA (Guanine(26)-N(2))-dimethyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
618980 .. 623170
4191 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28264

Sequence Viewer

Length: 123 bp
ATGAACTTTGCATTCTCCAAGATGATGGGACCCTTCCCCAACCAGGCAAATTTTGTTGCGTCTCTTAGCAAGGCACAGACCAAGAAGGTTGCACGGTTCCTTCCAAACCTGGAAAGGCATTGA

Protein Analysis

40

Amino Acids

4.56

Weight (kDa)

11.17

Isoelectric Point (pI)

24.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 49
AfiI CCNNNNNNNGG 1 cut(s) 43
AjnI CCWGG 2 cut(s) 42, 108
Alw26I GTCTC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 49
AspS9I GGNCC 1 cut(s) 29
AvaII GGWCC 1 cut(s) 29
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 2 cut(s) 44, 110
BcoDI GTCTC 1 cut(s) 66
Bme1390I CCNGG 2 cut(s) 44, 110
Bme18I GGWCC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 29
BmiI GGNNCC 3 cut(s) 30, 31, 98
BmrFI CCNGG 2 cut(s) 44, 110
Bsc4I CCNNNNNNNGG 1 cut(s) 43
BseBI CCWGG 2 cut(s) 44, 110
BseLI CCNNNNNNNGG 1 cut(s) 43
BslFI GGGAC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 43
BsmAI GTCTC 1 cut(s) 66
BsmBI CGTCTC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 42
BsmI GAATGC 1 cut(s) 11
BspLI GGNNCC 3 cut(s) 30, 31, 98
Bst2UI CCWGG 2 cut(s) 44, 110
Bst4CI ACNGT 1 cut(s) 96
BstDEI CTNAG 1 cut(s) 65
BstMAI GTCTC 1 cut(s) 66
BstNI CCWGG 2 cut(s) 44, 110
BstSCI CCNGG 2 cut(s) 42, 108
BstXI CCANNNNNNTGG 1 cut(s) 25
Cfr13I GGNCC 1 cut(s) 29
CseI GACGC 1 cut(s) 48
DdeI CTNAG 1 cut(s) 65
Eco47I GGWCC 1 cut(s) 29
EcoO109I RGGNCCY 1 cut(s) 29
EcoRII CCWGG 2 cut(s) 42, 108
Esp3I CGTCTC 1 cut(s) 66
FaqI GGGAC 1 cut(s) 42
HgaI GACGC 1 cut(s) 48
HpyAV CCTTC 3 cut(s) 43, 79, 110
HpyCH4III ACNGT 1 cut(s) 96
HpyCH4V TGCA 2 cut(s) 11, 92
HpyF3I CTNAG 1 cut(s) 65
KflI GGGWCCC 1 cut(s) 29
LpnPI CCDG 3 cut(s) 29, 56, 95
MluCI AATT 1 cut(s) 49
MspR9I CCNGG 2 cut(s) 44, 110
Mva1269I GAATGC 1 cut(s) 11
MvaI CCWGG 2 cut(s) 44, 110
NlaIV GGNNCC 3 cut(s) 30, 31, 98
PctI GAATGC 1 cut(s) 11
PpuMI RGGWCCY 1 cut(s) 29
Psp5II RGGWCCY 1 cut(s) 29
Psp6I CCWGG 2 cut(s) 42, 108
PspGI CCWGG 2 cut(s) 42, 108
PspN4I GGNNCC 3 cut(s) 30, 31, 98
PspPI GGNCC 1 cut(s) 29
PspPPI RGGWCCY 1 cut(s) 29
Sau96I GGNCC 1 cut(s) 29
ScrFI CCNGG 2 cut(s) 44, 110
SetI ASST 2 cut(s) 90, 111
SgeI CNNG 6 cut(s) 31, 55, 56, 82, 94, 105
SinI GGWCC 1 cut(s) 29
Sse9I AATT 1 cut(s) 49
StyD4I CCNGG 2 cut(s) 42, 108
TaaI ACNGT 1 cut(s) 96
TasI AATT 1 cut(s) 49
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 29
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.