Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001097.1

Orthogroup ID

OG0004894

Physical Location & Seq

Genomic Coordinates Forward (+)

80004 .. 83090

Gene Structure 3087 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001097.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1395 bp

atggggtttctgttgtccaagctaaccagtttggccactgttgttctatttgggcttggtttctgcagcttcttcacctcaacagatgcatatgatccgcttgatcctaatggcaacatcacaattaagtgggatgcatatgatccgcttgatcctaatggcaacatcacaattaagtgggatattataagctggacacctgatggctatgttgccgttgttacgctttttaacttccagcagtatagacacattcaagcaccaggctggacgcttggatggacatgggcaaagaaggaggtaatttggaacatggtgggaggacaagccaccgatcaaggcgattgttcaaaatttaagacaactcccccacattgctgcaaaaagaccccaaccattgttgatctactccctggaactccgtacaatcagcagtattccaattgttgtagagggggagtgctgagctcatggatacaggatccatccaatgctgcagcttcttttcaaataagtgttggtcgatctggaacgaccaacaagacagttaggcttccgaaaaactataccctattaggacctgggcctgggtatacttgtggtgtggcaaaagttgttaaaccaactaaattctttacagctgataaaagaagagtctctcaagccctgatgacatggaatgtgacatgcacatattcacagttcctggctcagaaagctcctacttgctgtgtctcgttgtcttccttctacaatgacacagtagttccctgcccgacatgttcgtgtggctgccaaaacaacataactcatcctggaagctgtgtagtgccagagtctccgtatttggcttcagttgtttcagctgctgataagaattcacctttggttagatgtactagccatatgtgccctatcagagttcattggcacgtcaagctgaattacaaggaatactggcgagtgaaggtcacaattacaaactttgattacaggaggaattattctgattggaacttggttgcccaacacccaaattttgacaatcttaccgaaattttcagcttcaacgcaaagtccttgactccttatggaaccataaatgatactgtaatgctatggggaaccaagttctacaacgacatgctggtgcaatctgggcctctcggtaatgtgcagtcagagatgcttttccggaagaatccagccaccttcacttttgacaagggatgggcgttcccaagaaggatctatttcaatggtgatacttgtgtaatgccacccccagatgcctttccacatttgccaaatgctggtttccgacagtatgtttctctgcttactgtgatcatgatttcagcatcaacatttgcattcacatatgcctatgcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

COBRA

Protein Analysis

464

Amino Acids

51.87

Weight (kDa)

8.82

Isoelectric Point (pI)

31.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004894)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02210 AT3G29810
fragaria_vesca	FvH4_6g46460 FvH4_6g46530
malus_domestica	MD09G1072800.v1.1 MD17G1064200.v1.1
prunus_persica	Prupe.3G250400_v2.0.a1 Prupe.3G250400_v2.0.a1
pyrus_communis	pycom12433g00030 pycom17g06430
rosa_chinensis	RchiOBHm_Chr2g0153051 RchiOBHm_Chr2g0165011 RchiOBHm_Chr2g0165171 RchiOBHm_Chr5g0001191
rosa_multiflora	Rmu_sc0001097.1_g000020 Rmu_sc0001097.1_g000043
rosa_roxburghii	Rroxscaffold_2G00085970 Rroxscaffold_2G00086120
rosa_rugosa	Rorug02G0512200 Rorug02G0512300 Rorug02G0512900
rosa_samantha	Rh2AG580300 Rh2AG581100 Rh2BG591600 Rh2BG592400 Rh2CG562100 Rh2CG563100 Rh2DG601700 Rh2DG602400
rosa_wichuraiana	Rw2G048170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	188
AccB7I	CCANNNNNTGG	1 cut(s)	1313
AccI	GTMKAC	1 cut(s)	593
AccIII	TCCGGA	1 cut(s)	1194
AciI	CCGC	2 cut(s)	98, 146
AclWI	GGATC	7 cut(s)	89, 98, 137, 146, 476, 489, 1256
AcoI	YGGCCR	1 cut(s)	33
AcsI	RAATTY	5 cut(s)	353, 629, 877, 1036, 1056
AcuI	CTGAAG	1 cut(s)	837
AfaI	GTAC	2 cut(s)	425, 898
AfiI	CCNNNNNNNGG	2 cut(s)	587, 1313
AflIII	ACRYGT	1 cut(s)	779
AgsI	TTSAA	5 cut(s)	257, 351, 509, 1069, 1258
AjiI	CACGTC	1 cut(s)	934
AjnI	CCWGG	6 cut(s)	262, 412, 580, 586, 705, 814
AjuI	GAANNNNNNNTTGG	2 cut(s)	869, 901
Alw21I	GWGCWC	1 cut(s)	470
Alw26I	GTCTC	3 cut(s)	661, 739, 843
AlwI	GGATC	7 cut(s)	89, 98, 137, 146, 476, 489, 1256
AlwNI	CAGNNNCTG	2 cut(s)	706, 869
Aor13HI	TCCGGA	1 cut(s)	1194
AoxI	GGCC	3 cut(s)	33, 584, 1160
ApeKI	GCWGC	6 cut(s)	66, 378, 494, 497, 792, 866
ApoI	RAATTY	5 cut(s)	353, 629, 877, 1036, 1056
AspS9I	GGNCC	3 cut(s)	578, 584, 1160
AsuHPI	GGTGA	3 cut(s)	67, 873, 1274
AvaII	GGWCC	1 cut(s)	578
BaeGI	GKGCMC	1 cut(s)	914
BaeI	ACNNNNGTAYC	2 cut(s)	1257, 1290
BalI	TGGCCA	1 cut(s)	35
BamHI	GGATCC	1 cut(s)	481
BanII	GRGCYC	1 cut(s)	470
BbsI	GAAGAC	1 cut(s)	735
Bbv12I	GWGCWC	1 cut(s)	470
BbvI	GCAGC	6 cut(s)	78, 365, 481, 509, 779, 853
BccI	CCATC	4 cut(s)	197, 273, 493, 1224
BceAI	ACGGC	1 cut(s)	200
BciT130I	CCWGG	6 cut(s)	264, 414, 582, 588, 707, 816
BciVI	GTATCC	1 cut(s)	468
BclI	TGATCA	1 cut(s)	1347
BcoDI	GTCTC	3 cut(s)	661, 739, 843
BfaI	CTAG	1 cut(s)	900
BfmI	CTRYAG	2 cut(s)	64, 495
BfuI	GTATCC	1 cut(s)	468
BisI	GCNGC	6 cut(s)	67, 379, 495, 498, 793, 867
BlpI	GCTNAGC	1 cut(s)	464
BlsI	GCNGC	6 cut(s)	68, 380, 496, 499, 794, 868
Bme1390I	CCNGG	6 cut(s)	264, 414, 582, 588, 707, 816
Bme18I	GGWCC	1 cut(s)	578
BmgBI	CACGTC	1 cut(s)	934
BmgT120I	GGNCC	3 cut(s)	578, 584, 1160
BmiI	GGNNCC	3 cut(s)	483, 1096, 1126
BmrFI	CCNGG	6 cut(s)	264, 414, 582, 588, 707, 816
BmsI	GCATC	5 cut(s)	76, 124, 1176, 1279, 1370
BpiI	GAAGAC	1 cut(s)	735
Bpu1102I	GCTNAGC	1 cut(s)	464
BpuEI	CTTGAG	1 cut(s)	645
BsaJI	CCNNGG	3 cut(s)	412, 581, 587
BsaWI	WCCGGW	1 cut(s)	1194
Bsc4I	CCNNNNNNNGG	2 cut(s)	587, 1313
Bse1I	ACTGG	2 cut(s)	27, 962
Bse3DI	GCAATG	1 cut(s)	373
BseAI	TCCGGA	1 cut(s)	1194
BseBI	CCWGG	6 cut(s)	264, 414, 582, 588, 707, 816
BseDI	CCNNGG	3 cut(s)	412, 581, 587
BseGI	GGATG	5 cut(s)	139, 284, 485, 811, 1235
BseLI	CCNNNNNNNGG	2 cut(s)	587, 1313
BseMI	GCAATG	1 cut(s)	373
BseMII	CTCAG	2 cut(s)	455, 725
BseNI	ACTGG	2 cut(s)	27, 962
BseSI	GKGCMC	1 cut(s)	914
BseXI	GCAGC	6 cut(s)	78, 365, 481, 509, 779, 853
BsgI	GTGCAG	1 cut(s)	1196
BshFI	GGCC	3 cut(s)	35, 586, 1162
BsiHKAI	GWGCWC	1 cut(s)	470
BsiSI	CCGG	1 cut(s)	1195
BslI	CCNNNNNNNGG	2 cut(s)	587, 1313
BsmAI	GTCTC	3 cut(s)	661, 739, 843
BsmI	GAATGC	1 cut(s)	1373
BsnI	GGCC	3 cut(s)	35, 586, 1162
Bsp1286I	GDGCHC	2 cut(s)	470, 914
Bsp13I	TCCGGA	1 cut(s)	1194
Bsp1720I	GCTNAGC	1 cut(s)	464
BspACI	CCGC	2 cut(s)	98, 146
BspANI	GGCC	3 cut(s)	35, 586, 1162
BspCNI	CTCAG	2 cut(s)	456, 724
BspEI	TCCGGA	1 cut(s)	1194
BspHI	TCATGA	1 cut(s)	1350
BspLI	GGNNCC	3 cut(s)	483, 1096, 1126
BspMAI	CTGCAG	2 cut(s)	68, 499
BspPI	GGATC	7 cut(s)	89, 98, 137, 146, 476, 489, 1256
BsrDI	GCAATG	1 cut(s)	373
BsrI	ACTGG	2 cut(s)	27, 962
BssECI	CCNNGG	3 cut(s)	412, 581, 587
BssNAI	GTATAC	1 cut(s)	594
Bst1107I	GTATAC	1 cut(s)	594
Bst2UI	CCWGG	6 cut(s)	264, 414, 582, 588, 707, 816
Bst4CI	ACNGT	7 cut(s)	40, 547, 702, 763, 1111, 1326, 1345
Bst6I	CTCTTC	1 cut(s)	646
BstDEI	CTNAG	3 cut(s)	464, 711, 1392
BstF5I	GGATG	5 cut(s)	139, 284, 485, 811, 1235
BstMAI	GTCTC	3 cut(s)	661, 739, 843
BstMWI	GCNNNNNNNGC	4 cut(s)	716, 909, 937, 1159
BstNI	CCWGG	6 cut(s)	264, 414, 582, 588, 707, 816
BstNSI	RCATGY	3 cut(s)	690, 783, 1147
BstSCI	CCNGG	6 cut(s)	262, 412, 580, 586, 705, 814
BstSFI	CTRYAG	2 cut(s)	64, 495
BstSLI	GKGCMC	1 cut(s)	914
BstV1I	GCAGC	6 cut(s)	78, 365, 481, 509, 779, 853
BstV2I	GAAGAC	1 cut(s)	735
BstX2I	RGATCY	2 cut(s)	481, 1248
BstYI	RGATCY	2 cut(s)	481, 1248
BstZ17I	GTATAC	1 cut(s)	594
BsuI	GTATCC	1 cut(s)	468
BsuRI	GGCC	3 cut(s)	35, 586, 1162
BtrI	CACGTC	1 cut(s)	934
BtsCI	GGATG	5 cut(s)	139, 284, 485, 811, 1235
BtsIMutI	CAGTG	1 cut(s)	36
CaiI	CAGNNNCTG	2 cut(s)	706, 869
CciI	TCATGA	1 cut(s)	1350
Cfr13I	GGNCC	3 cut(s)	578, 584, 1160
CseI	GACGC	1 cut(s)	280
Csp6I	GTAC	2 cut(s)	424, 897
CviAII	CATG	8 cut(s)	285, 313, 471, 675, 687, 780, 1144, 1351
CviQI	GTAC	2 cut(s)	424, 897
DdeI	CTNAG	3 cut(s)	464, 711, 1392
EaeI	YGGCCR	1 cut(s)	33
Eam1104I	CTCTTC	1 cut(s)	646
EarI	CTCTTC	1 cut(s)	646
Ecl136II	GAGCTC	1 cut(s)	468
Eco24I	GRGCYC	1 cut(s)	470
Eco47I	GGWCC	1 cut(s)	578
Eco53kI	GAGCTC	1 cut(s)	468
Eco57I	CTGAAG	1 cut(s)	837
EcoICRI	GAGCTC	1 cut(s)	468
EcoO109I	RGGNCCY	1 cut(s)	578
EcoRI	GAATTC	1 cut(s)	877
EcoRII	CCWGG	6 cut(s)	262, 412, 580, 586, 705, 814
EcoT22I	ATGCAT	2 cut(s)	91, 139
EcoT38I	GRGCYC	1 cut(s)	470
FaeI	CATG	8 cut(s)	288, 316, 474, 678, 690, 783, 1147, 1354
FatI	CATG	8 cut(s)	284, 312, 470, 674, 686, 779, 1143, 1350
FauNDI	CATATG	4 cut(s)	91, 139, 906, 1381
FbaI	TGATCA	1 cut(s)	1347
FblI	GTMKAC	1 cut(s)	593
Fnu4HI	GCNGC	6 cut(s)	67, 379, 495, 498, 793, 867
FokI	GGATG	5 cut(s)	146, 291, 472, 798, 1242
FriOI	GRGCYC	1 cut(s)	470
Fsp4HI	GCNGC	6 cut(s)	67, 379, 495, 498, 793, 867
FspBI	CTAG	1 cut(s)	900
GluI	GCNGC	6 cut(s)	67, 379, 495, 498, 793, 867
HaeIII	GGCC	3 cut(s)	35, 586, 1162
HapII	CCGG	1 cut(s)	1195
HgaI	GACGC	1 cut(s)	280
Hin1II	CATG	8 cut(s)	288, 316, 474, 678, 690, 783, 1147, 1354
HinfI	GANTC	4 cut(s)	654, 836, 1084, 1201
HpaII	CCGG	1 cut(s)	1195
HphI	GGTGA	3 cut(s)	67, 873, 1274
Hpy166II	GTNNAC	1 cut(s)	594
Hpy188I	TCNGA	6 cut(s)	558, 714, 920, 1009, 1183, 1322
Hpy188III	TCNNGA	3 cut(s)	528, 1195, 1351
Hpy8I	GTNNAC	1 cut(s)	594
HpyAV	CCTTC	5 cut(s)	289, 757, 961, 1222, 1239
HpyCH4III	ACNGT	7 cut(s)	40, 547, 702, 763, 1111, 1326, 1345
HpyCH4IV	ACGT	1 cut(s)	933
HpyCH4V	TGCA	9 cut(s)	66, 89, 137, 381, 497, 690, 1153, 1177, 1373
HpyF10VI	GCNNNNNNNGC	4 cut(s)	716, 909, 937, 1159
HpyF3I	CTNAG	3 cut(s)	464, 711, 1392
HpySE526I	ACGT	1 cut(s)	933
Hsp92II	CATG	8 cut(s)	288, 316, 474, 678, 690, 783, 1147, 1354
Kpn2I	TCCGGA	1 cut(s)	1194
Ksp22I	TGATCA	1 cut(s)	1347
LmnI	GCTCC	1 cut(s)	724
Lsp1109I	GCAGC	6 cut(s)	78, 365, 481, 509, 779, 853
LweI	GCATC	5 cut(s)	76, 124, 1176, 1279, 1370
MaeI	CTAG	1 cut(s)	900
MaeII	ACGT	1 cut(s)	933
MaeIII	GTNAC	3 cut(s)	220, 682, 970
MboII	GAAGA	4 cut(s)	64, 663, 735, 1210
MfeI	CAATTG	1 cut(s)	442
MflI	RGATCY	2 cut(s)	481, 1248
MhlI	GDGCHC	2 cut(s)	470, 914
MlsI	TGGCCA	1 cut(s)	35
MluNI	TGGCCA	1 cut(s)	35
MlyI	GAGTC	3 cut(s)	663, 845, 1078
MmeI	TCCRAC	1 cut(s)	1345
MnlI	CCTC	6 cut(s)	88, 292, 314, 446, 990, 1173
Mox20I	TGGCCA	1 cut(s)	35
Mph1103I	ATGCAT	2 cut(s)	91, 139
MroI	TCCGGA	1 cut(s)	1194
MscI	TGGCCA	1 cut(s)	35
MseI	TTAA	5 cut(s)	126, 174, 231, 357, 618
MslI	CAYNNNNRTG	2 cut(s)	784, 1148
Msp20I	TGGCCA	1 cut(s)	35
MspA1I	CMGCKG	2 cut(s)	641, 866
MspI	CCGG	1 cut(s)	1195
MspR9I	CCNGG	6 cut(s)	264, 414, 582, 588, 707, 816
MunI	CAATTG	1 cut(s)	442
Mva1269I	GAATGC	1 cut(s)	1373
MvaI	CCWGG	6 cut(s)	264, 414, 582, 588, 707, 816
MwoI	GCNNNNNNNGC	4 cut(s)	716, 909, 937, 1159
NdeI	CATATG	4 cut(s)	91, 139, 906, 1381
NlaIII	CATG	8 cut(s)	288, 316, 474, 678, 690, 783, 1147, 1354
NlaIV	GGNNCC	3 cut(s)	483, 1096, 1126
NmuCI	GTSAC	2 cut(s)	682, 970
NsiI	ATGCAT	2 cut(s)	91, 139
NspI	RCATGY	3 cut(s)	690, 783, 1147
PagI	TCATGA	1 cut(s)	1350
PciI	ACATGT	1 cut(s)	779
PctI	GAATGC	1 cut(s)	1373
PfeI	GAWTC	1 cut(s)	1201
PflMI	CCANNNNNTGG	1 cut(s)	1313
PfoI	TCCNGGA	1 cut(s)	814
PkrI	GCNGC	6 cut(s)	68, 380, 496, 499, 794, 868
PleI	GAGTC	3 cut(s)	662, 844, 1078
PpsI	GAGTC	3 cut(s)	662, 844, 1078
PpuMI	RGGWCCY	1 cut(s)	578
PscI	ACATGT	1 cut(s)	779
PsiI	TTATAA	1 cut(s)	188
Psp124BI	GAGCTC	1 cut(s)	470
Psp5II	RGGWCCY	1 cut(s)	578
Psp6I	CCWGG	6 cut(s)	262, 412, 580, 586, 705, 814
PspGI	CCWGG	6 cut(s)	262, 412, 580, 586, 705, 814
PspN4I	GGNNCC	3 cut(s)	483, 1096, 1126
PspPI	GGNCC	3 cut(s)	578, 584, 1160
PspPPI	RGGWCCY	1 cut(s)	578
PstI	CTGCAG	2 cut(s)	68, 499
PstNI	CAGNNNCTG	2 cut(s)	706, 869
PsuI	RGATCY	2 cut(s)	481, 1248
PvuII	CAGCTG	2 cut(s)	641, 866
RsaI	GTAC	2 cut(s)	425, 898
RsaNI	GTAC	2 cut(s)	424, 897
RseI	CAYNNNNRTG	2 cut(s)	784, 1148
SacI	GAGCTC	1 cut(s)	470
SaqAI	TTAA	5 cut(s)	126, 174, 231, 357, 618
SatI	GCNGC	6 cut(s)	67, 379, 495, 498, 793, 867
Sau96I	GGNCC	3 cut(s)	578, 584, 1160
SchI	GAGTC	3 cut(s)	663, 845, 1078
ScrFI	CCNGG	6 cut(s)	264, 414, 582, 588, 707, 816
SduI	GDGCHC	2 cut(s)	470, 914
SfaNI	GCATC	5 cut(s)	76, 124, 1176, 1279, 1370
SfcI	CTRYAG	2 cut(s)	64, 495
SinI	GGWCC	1 cut(s)	578
SmiMI	CAYNNNNRTG	2 cut(s)	784, 1148
SmlI	CTYRAG	1 cut(s)	660
SmoI	CTYRAG	1 cut(s)	660
SsiI	CCGC	2 cut(s)	98, 146
SspMI	CTAG	1 cut(s)	900
SstI	GAGCTC	1 cut(s)	470
StyD4I	CCNGG	6 cut(s)	262, 412, 580, 586, 705, 814
TaaI	ACNGT	7 cut(s)	40, 547, 702, 763, 1111, 1326, 1345
TaiI	ACGT	1 cut(s)	936
TaqI	TCGA	1 cut(s)	523
TatI	WGTACW	1 cut(s)	896
TfiI	GAWTC	1 cut(s)	1201
Tru1I	TTAA	5 cut(s)	126, 174, 231, 357, 618
Tru9I	TTAA	5 cut(s)	126, 174, 231, 357, 618
TscAI	CASTG	1 cut(s)	43
TseFI	GTSAC	2 cut(s)	682, 970
TseI	GCWGC	6 cut(s)	66, 378, 494, 497, 792, 866
Tsp45I	GTSAC	2 cut(s)	682, 970
TspDTI	ATGAA	1 cut(s)	914
TspGWI	ACGGA	2 cut(s)	411, 831
TspRI	CASTG	1 cut(s)	43
Van91I	CCANNNNNTGG	1 cut(s)	1313
VpaK11BI	GGWCC	1 cut(s)	578
XapI	RAATTY	5 cut(s)	353, 629, 877, 1036, 1056
XceI	RCATGY	3 cut(s)	690, 783, 1147
XmiI	GTMKAC	1 cut(s)	593
XspI	CTAG	1 cut(s)	900
Zsp2I	ATGCAT	2 cut(s)	91, 139

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.