RchiOBHm_Chr4g0401141

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
19126685 .. 19127589
905 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37309

Sequence Viewer

Length: 132 bp
ATGAGTAAGAGCAAACAAAGGATCAGCCTTGGTTTGAGAAAAATCAAAACTTTGTTTTCTGAGGTGTTAATCGAGCAGGGATGTACCAATTATGCAGGGCTGCAGGCAGATTCTAAGTGTGAACCTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

43

Amino Acids

4.8

Weight (kDa)

9.18

Isoelectric Point (pI)

73.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 29
AfaI GTAC 1 cut(s) 85
AlwI GGATC 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 100
BbvI GCAGC 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 101
BisI GCNGC 1 cut(s) 101
BlsI GCNGC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 28
BseGI GGATG 1 cut(s) 86
BseMII CTCAG 1 cut(s) 51
BseXI GCAGC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 21
BspCNI CTCAG 1 cut(s) 52
BspMAI CTGCAG 1 cut(s) 105
BspPI GGATC 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 28
BssMI GATC 1 cut(s) 21
BssT1I CCWWGG 1 cut(s) 28
BstC8I GCNNGC 1 cut(s) 105
BstDEI CTNAG 2 cut(s) 60, 114
BstF5I GGATG 1 cut(s) 86
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 101
BstV1I GCAGC 1 cut(s) 87
BtsCI GGATG 1 cut(s) 86
Cac8I GCNNGC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 84
CviJI RGCY 2 cut(s) 27, 100
CviKI_1 RGCY 2 cut(s) 27, 100
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 2 cut(s) 60, 114
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eco130I CCWWGG 1 cut(s) 28
EcoT14I CCWWGG 1 cut(s) 28
ErhI CCWWGG 1 cut(s) 28
FaiI YATR 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 101
FokI GGATG 1 cut(s) 93
Fsp4HI GCNGC 1 cut(s) 101
GluI GCNGC 1 cut(s) 101
HinfI GANTC 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 61
Hpy8I GTNNAC 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 95, 103
HpyF3I CTNAG 2 cut(s) 60, 114
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 3 cut(s) 62, 81, 89
Lsp1109I GCAGC 1 cut(s) 87
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MluCI AATT 1 cut(s) 88
MnlI CCTC 1 cut(s) 55
MseI TTAA 1 cut(s) 68
NdeII GATC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 110
PkrI GCNGC 1 cut(s) 102
PstI CTGCAG 1 cut(s) 105
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SaqAI TTAA 1 cut(s) 68
SatI GCNGC 1 cut(s) 101
Sau3AI GATC 1 cut(s) 21
SetI ASST 2 cut(s) 66, 127
SfcI CTRYAG 1 cut(s) 101
SgeI CNNG 5 cut(s) 41, 85, 89, 108, 116
Sse9I AATT 1 cut(s) 88
StyI CCWWGG 1 cut(s) 28
TaqI TCGA 1 cut(s) 72
TasI AATT 1 cut(s) 88
TfiI GAWTC 1 cut(s) 110
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TseI GCWGC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.