RchiOBHm_Chr4g0425941

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
51504167 .. 51507247
3081 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39502

Sequence Viewer

Length: 252 bp
ATGAGAGTATTTGATGACATTGGGACTGAATACCTTGTTAGGCCAGTAGCCCGTGCGGAGGATGAGGAAGATGCAAGTGATTTTGAACCTGAAGAGAATGGAGAAGATGAAGATGTTGAGGAAGAAGAGGATGACGACGATGACGCTGGTGGGAAGGTTGAGGCTCCGCCAAAGAGGAAGAGATCAGACAAGGATGATTCAGATGACGATGATGATGGTGGAGAGGATGATGTGAGACCCTCTAAGCGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.38

Weight (kDa)

4.05

Isoelectric Point (pI)

78.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 56, 167
AcuI CTGAAG 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 58
AgsI TTSAA 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 229
AoxI GGCC 1 cut(s) 41
BccI CCATC 1 cut(s) 209
BcoDI GTCTC 1 cut(s) 229
BmiI GGNNCC 1 cut(s) 165
BmsI GCATC 1 cut(s) 61
BsaI GGTCTC 1 cut(s) 229
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 44
BseGI GGATG 4 cut(s) 67, 136, 199, 232
BseLI CCNNNNNNNGG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 44
BshFI GGCC 1 cut(s) 43
BslFI GGGAC 1 cut(s) 37
BslI CCNNNNNNNGG 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 229
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 1 cut(s) 43
Bso31I GGTCTC 1 cut(s) 229
Bsp143I GATC 1 cut(s) 182
BspACI CCGC 2 cut(s) 56, 167
BspANI GGCC 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 165
BspTNI GGTCTC 1 cut(s) 229
BsrI ACTGG 1 cut(s) 44
BssMI GATC 1 cut(s) 182
Bst6I CTCTTC 3 cut(s) 87, 120, 173
BstDEI CTNAG 1 cut(s) 243
BstF5I GGATG 4 cut(s) 67, 136, 199, 232
BstKTI GATC 1 cut(s) 185
BstMAI GTCTC 1 cut(s) 229
BstMBI GATC 1 cut(s) 182
BsuRI GGCC 1 cut(s) 43
BtsCI GGATG 4 cut(s) 67, 136, 199, 232
CseI GACGC 1 cut(s) 152
CviJI RGCY 3 cut(s) 43, 50, 164
CviKI_1 RGCY 3 cut(s) 43, 50, 164
DdeI CTNAG 1 cut(s) 243
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
Eam1104I CTCTTC 3 cut(s) 87, 120, 173
EarI CTCTTC 3 cut(s) 87, 120, 173
EciI GGCGGA 1 cut(s) 156
Eco31I GGTCTC 1 cut(s) 229
Eco57I CTGAAG 1 cut(s) 111
FaqI GGGAC 1 cut(s) 37
FokI GGATG 4 cut(s) 74, 143, 206, 239
HaeIII GGCC 1 cut(s) 43
HgaI GACGC 1 cut(s) 152
HinfI GANTC 1 cut(s) 197
Hpy188I TCNGA 2 cut(s) 187, 202
Hpy99I CGWCG 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 243
Kzo9I GATC 1 cut(s) 182
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 3 cut(s) 57, 102, 132
LweI GCATC 1 cut(s) 61
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MboII GAAGA 7 cut(s) 80, 104, 116, 122, 134, 137, 190
MnlI CCTC 8 cut(s) 52, 58, 112, 121, 154, 168, 217, 250
NdeII GATC 1 cut(s) 182
NlaIV GGNNCC 1 cut(s) 165
PfeI GAWTC 1 cut(s) 197
PspN4I GGNNCC 1 cut(s) 165
Sau3AI GATC 1 cut(s) 182
SetI ASST 3 cut(s) 36, 91, 159
SfaNI GCATC 1 cut(s) 61
SgeI CNNG 8 cut(s) 47, 56, 63, 65, 87, 101, 159, 202
SsiI CCGC 2 cut(s) 56, 167
TfiI GAWTC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.