Rh6DG338900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
54287324 .. 54287557
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG338900.1

Sequence Viewer

Length: 234 bp
ATGAAGGTTATGGAGGAAGTTGTGGAGGAAAACGAAGTGAAGCCTTTGACTGCCGAGGAATTGGAGCAGTACGAGTCCTCCGACTCTAACTCTGACTCCGACGGCCTCGAAGACTCTCCTTTGAGGAAGAGAGTGAGAAATAGAGACAGTAAATTGGTACTTGATCGAGTTTATGTATTAGGTGATAGGATTGAGGTTGAAGTTCTCTTTACTTTTCTGGGTAAATGTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.87

Weight (kDa)

4.46

Isoelectric Point (pI)

54.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 71, 159
AgsI TTSAA 1 cut(s) 200
Alw26I GTCTC 1 cut(s) 138
AoxI GGCC 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 194
BbsI GAAGAC 1 cut(s) 117
BceAI ACGGC 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 54
BsaXI ACNNNNNCTCC 4 cut(s) 62, 80, 92, 110
BseDI CCNNGG 1 cut(s) 54
BshFI GGCC 1 cut(s) 105
BsmAI GTCTC 1 cut(s) 138
BsnI GGCC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 163
BspANI GGCC 1 cut(s) 105
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 163
Bst4CI ACNGT 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 122
BstKTI GATC 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 1 cut(s) 163
BstV2I GAAGAC 1 cut(s) 117
BsuRI GGCC 1 cut(s) 105
Csp6I GTAC 2 cut(s) 70, 158
CviJI RGCY 2 cut(s) 43, 105
CviKI_1 RGCY 2 cut(s) 43, 105
CviQI GTAC 2 cut(s) 70, 158
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eam1104I CTCTTC 1 cut(s) 122
EarI CTCTTC 1 cut(s) 122
FaiI YATR 3 cut(s) 11, 174, 232
HaeIII GGCC 1 cut(s) 105
HinfI GANTC 4 cut(s) 74, 83, 95, 113
HphI GGTGA 1 cut(s) 194
Hpy188I TCNGA 3 cut(s) 82, 94, 100
Hpy99I CGWCG 1 cut(s) 104
HpyCH4III ACNGT 1 cut(s) 149
Kzo9I GATC 1 cut(s) 163
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 203
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 2 cut(s) 122, 139
MluCI AATT 2 cut(s) 59, 152
MlyI GAGTC 4 cut(s) 77, 83, 89, 107
MmeI TCCRAC 2 cut(s) 105, 123
MnlI CCTC 7 cut(s) 7, 19, 49, 88, 116, 117, 187
NdeII GATC 1 cut(s) 163
NmeAIII GCCGAG 1 cut(s) 79
PcsI WCGNNNNNNNCGW 1 cut(s) 78
PleI GAGTC 4 cut(s) 77, 82, 89, 107
PpsI GAGTC 4 cut(s) 77, 82, 89, 107
RsaI GTAC 2 cut(s) 71, 159
RsaNI GTAC 2 cut(s) 70, 158
Sau3AI GATC 1 cut(s) 163
SchI GAGTC 4 cut(s) 77, 83, 89, 107
SetI ASST 3 cut(s) 9, 184, 198
SgeI CNNG 6 cut(s) 67, 85, 119, 173, 179, 230
Sse9I AATT 2 cut(s) 59, 152
TaaI ACNGT 1 cut(s) 149
TaqI TCGA 2 cut(s) 108, 166
TasI AATT 2 cut(s) 59, 152
TspDTI ATGAA 2 cut(s) 17, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.