Rh3DG073600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
4980049 .. 4982214
2166 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG073600.1

Sequence Viewer

Length: 212 bp
ATGAAGGTTATGGAGGAAGTTGTGGAGGAAAACGAAGCGAAGCCTTTGACTGCCGAGGAATTGGAGCAGTACGAGTCCGTTTCCGAGTCCTCCGACTCTGACTTCGATGATGGTCTCGAAGACGAGGAAGAGGACGGTGATGAAGACGACGACAACGTCGTTGATGATGATGATGTCCAGGAGATCCACCATACATTCAAGCCGTTGTTTAT
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.05

Weight (kDa)

4.05

Isoelectric Point (pI)

56.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 155
AclWI GGATC 1 cut(s) 178
AfaI GTAC 1 cut(s) 71
AgsI TTSAA 1 cut(s) 199
AjnI CCWGG 1 cut(s) 177
Alw26I GTCTC 1 cut(s) 119
AlwI GGATC 1 cut(s) 178
ArsI GACNNNNNNTTYG 2 cut(s) 86, 118
AsuHPI GGTGA 1 cut(s) 149
BbsI GAAGAC 2 cut(s) 126, 150
BccI CCATC 1 cut(s) 104
BceAI ACGGC 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 179
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 179
BpiI GAAGAC 2 cut(s) 126, 150
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 54
BseBI CCWGG 1 cut(s) 179
BseDI CCNNGG 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 119
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 183
BspPI GGATC 1 cut(s) 178
BspTNI GGTCTC 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 1 cut(s) 183
Bst2UI CCWGG 1 cut(s) 179
Bst4CI ACNGT 1 cut(s) 137
Bst6I CTCTTC 1 cut(s) 123
BstKTI GATC 1 cut(s) 186
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 183
BstNI CCWGG 1 cut(s) 179
BstSCI CCNGG 1 cut(s) 177
BstV2I GAAGAC 2 cut(s) 126, 150
BstX2I RGATCY 1 cut(s) 183
BstYI RGATCY 1 cut(s) 183
Csp6I GTAC 1 cut(s) 70
CviJI RGCY 2 cut(s) 43, 202
CviKI_1 RGCY 2 cut(s) 43, 202
CviQI GTAC 1 cut(s) 70
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
DrdI GACNNNNNNGTC 1 cut(s) 155
DseDI GACNNNNNNGTC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco31I GGTCTC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 177
FaiI YATR 2 cut(s) 11, 192
HinfI GANTC 3 cut(s) 74, 86, 95
HphI GGTGA 1 cut(s) 149
Hpy188I TCNGA 3 cut(s) 85, 94, 100
Hpy188III TCNNGA 1 cut(s) 116
Hpy99I CGWCG 2 cut(s) 152, 161
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4IV ACGT 1 cut(s) 156
HpySE526I ACGT 1 cut(s) 156
Kzo9I GATC 1 cut(s) 183
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 164, 191
MaeII ACGT 1 cut(s) 156
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 3 cut(s) 131, 140, 155
MflI RGATCY 1 cut(s) 183
MluCI AATT 1 cut(s) 59
MlyI GAGTC 3 cut(s) 83, 89, 95
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 6 cut(s) 7, 19, 49, 100, 118, 124
MspR9I CCNGG 1 cut(s) 179
MvaI CCWGG 1 cut(s) 179
NdeII GATC 1 cut(s) 183
NmeAIII GCCGAG 1 cut(s) 79
PcsI WCGNNNNNNNCGW 2 cut(s) 153, 156
PflFI GACNNNGTC 1 cut(s) 155
PfoI TCCNGGA 1 cut(s) 177
PleI GAGTC 3 cut(s) 82, 89, 94
PpsI GAGTC 3 cut(s) 82, 89, 94
Psp6I CCWGG 1 cut(s) 177
PspGI CCWGG 1 cut(s) 177
PsuI RGATCY 1 cut(s) 183
PsyI GACNNNGTC 1 cut(s) 155
RsaI GTAC 1 cut(s) 71
RsaNI GTAC 1 cut(s) 70
Sau3AI GATC 1 cut(s) 183
SchI GAGTC 3 cut(s) 83, 89, 95
ScrFI CCNGG 1 cut(s) 179
SetI ASST 2 cut(s) 9, 159
SgeI CNNG 7 cut(s) 67, 85, 97, 128, 136, 190, 191
Sse9I AATT 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 177
TaaI ACNGT 1 cut(s) 137
TaiI ACGT 1 cut(s) 159
TaqI TCGA 2 cut(s) 105, 117
TasI AATT 1 cut(s) 59
TspDTI ATGAA 2 cut(s) 17, 156
TspGWI ACGGA 1 cut(s) 67
Tth111I GACNNNGTC 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.