RchiOBHm_Chr5g0032061

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
25739125 .. 25740271
1147 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31126

Sequence Viewer

Length: 159 bp
ATGTGGAAACTGGTTCTGCTATCGATCGTCTTGGAAATGCTCAGGAGGATTAAGGTTATAAACTTGACCGCATCTACCATTGCCTTTGGAGATGATGAAGGTTGTATTAAGATCTGGGATACCAGACAACTATGTTGCTGCAATTCCTTTAATGCTTAG

Protein Analysis

52

Amino Acids

5.95

Weight (kDa)

7.65

Isoelectric Point (pI)

15.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 59
AciI CCGC 1 cut(s) 69
ApeKI GCWGC 1 cut(s) 138
BbvI GCAGC 1 cut(s) 125
BciVI GTATCC 1 cut(s) 112
BfuI GTATCC 1 cut(s) 112
BglII AGATCT 1 cut(s) 111
BisI GCNGC 1 cut(s) 139
BlsI GCNGC 1 cut(s) 140
BmsI GCATC 1 cut(s) 80
Bpu10I CCTNAGC 1 cut(s) 41
Bsa29I ATCGAT 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 15
Bse3DI GCAATG 1 cut(s) 78
BseCI ATCGAT 1 cut(s) 23
BseMI GCAATG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 15
BseXI GCAGC 1 cut(s) 125
Bsh1285I CGRYCG 1 cut(s) 27
BshVI ATCGAT 1 cut(s) 23
BsiEI CGRYCG 1 cut(s) 27
Bsp143I GATC 2 cut(s) 24, 111
BspACI CCGC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 54
BspDI ATCGAT 1 cut(s) 23
BsrDI GCAATG 1 cut(s) 78
BsrI ACTGG 1 cut(s) 15
BssMI GATC 2 cut(s) 24, 111
BstDEI CTNAG 2 cut(s) 41, 156
BstKTI GATC 2 cut(s) 27, 114
BstMBI GATC 2 cut(s) 24, 111
BstMCI CGRYCG 1 cut(s) 27
BstV1I GCAGC 1 cut(s) 125
BstX2I RGATCY 1 cut(s) 111
BstYI RGATCY 1 cut(s) 111
Bsu15I ATCGAT 1 cut(s) 23
BsuI GTATCC 1 cut(s) 112
BsuTUI ATCGAT 1 cut(s) 23
ClaI ATCGAT 1 cut(s) 23
DdeI CTNAG 2 cut(s) 41, 156
DpnI GATC 2 cut(s) 26, 113
DpnII GATC 2 cut(s) 24, 111
FaiI YATR 2 cut(s) 59, 133
Fnu4HI GCNGC 1 cut(s) 139
Fsp4HI GCNGC 1 cut(s) 139
GluI GCNGC 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 141
HpyF3I CTNAG 2 cut(s) 41, 156
Kzo9I GATC 2 cut(s) 24, 111
LpnPI CCDG 3 cut(s) 28, 100, 136
Lsp1109I GCAGC 1 cut(s) 125
LweI GCATC 1 cut(s) 80
MalI GATC 2 cut(s) 26, 113
MboI GATC 2 cut(s) 24, 111
MflI RGATCY 1 cut(s) 111
MluCI AATT 1 cut(s) 142
MnlI CCTC 1 cut(s) 39
MseI TTAA 3 cut(s) 51, 108, 150
NdeII GATC 2 cut(s) 24, 111
PkrI GCNGC 1 cut(s) 140
Ple19I CGATCG 1 cut(s) 27
PsiI TTATAA 1 cut(s) 59
PsuI RGATCY 1 cut(s) 111
PvuI CGATCG 1 cut(s) 27
SaqAI TTAA 3 cut(s) 51, 108, 150
SatI GCNGC 1 cut(s) 139
Sau3AI GATC 2 cut(s) 24, 111
SetI ASST 2 cut(s) 57, 103
SfaNI GCATC 1 cut(s) 80
SgeI CNNG 6 cut(s) 23, 43, 55, 76, 127, 135
Sse9I AATT 1 cut(s) 142
SsiI CCGC 1 cut(s) 69
TaqI TCGA 1 cut(s) 23
TasI AATT 1 cut(s) 142
Tru1I TTAA 3 cut(s) 51, 108, 150
Tru9I TTAA 3 cut(s) 51, 108, 150
TseI GCWGC 1 cut(s) 138
TspDTI ATGAA 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.