Rh4BG161000

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
29044099 .. 29045114
1016 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG161000.1

Sequence Viewer

Length: 459 bp
ATGGAAATAAACTTGGGGAAATTGGCGTTTGACCTCGATTTTCATCCATTGCAGCAATTAGTGACTACAGGTCTCATCGATGGCCACCTTTATTCATCTGGTGGTTCACTACCTGAAAGGGTGTTGGAAGTTCATGCACATAACGAATCTTGCAGAGCTGCTCGGTTCGTCAACGGTGGCAGTGCCATTTTGACGGGGTCTCTAGACCACACAATTCTTGCAACGGATGTGGAAACTGGTTCTGCTATCGCTTGTCTTGAAAATGCTCATGACGATGCAATCAATAGACTTATAAACTTGACCGCATCTACCATTGCCTCTGGAGATGATGGAGGCTGTATTAAGGTCTGGAATACCAGACAACGATCTTGCTGCAATTCCTTTAATGCTCATCAGGACTACATCTCCGATATGACTTTTTCAGCTGATTCCATGAAACTCCTGGGAACTAGGTCCTAG

Protein Analysis

152

Amino Acids

16.31

Weight (kDa)

5.15

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WDR55 PF24796 2 - 148 9.2e-36 WDR55
WD40_Prp19 PF24814 13 - 145 4e-09 Prp19 WD40 domain
Beta-prop_WDR3_1st PF25173 18 - 148 8.3e-13 WDR3 first beta-propeller domain
WD40_CDC20-Fz PF24807 18 - 148 7.1e-09 CDC20/Fizzy WD40 domain
Beta-prop_TEP1_2nd PF25047 42 - 140 1.9e-07 TEP-1 second beta-propeller
WD40_Gbeta PF25391 43 - 143 7.5e-07 G protein beta WD-40 repeat protein
Beta-prop_WDR5 PF25175 44 - 146 3.6e-12 WDR5 beta-propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 293
AciI CCGC 1 cut(s) 303
AcoI YGGCCR 1 cut(s) 82
AgsI TTSAA 1 cut(s) 260
AhdI GACNNNNNGTC 1 cut(s) 69
AjnI CCWGG 1 cut(s) 441
AluBI AGCT 2 cut(s) 158, 425
AluI AGCT 2 cut(s) 158, 425
Alw26I GTCTC 2 cut(s) 77, 204
AoxI GGCC 1 cut(s) 82
ApeKI GCWGC 3 cut(s) 52, 158, 372
AspS9I GGNCC 1 cut(s) 453
AvaII GGWCC 1 cut(s) 453
BalI TGGCCA 1 cut(s) 84
BbvI GCAGC 3 cut(s) 64, 145, 359
BccI CCATC 2 cut(s) 74, 323
BcgI CGANNNNNNTGC 2 cut(s) 354, 388
BciT130I CCWGG 1 cut(s) 443
BcoDI GTCTC 2 cut(s) 77, 204
BfaI CTAG 3 cut(s) 203, 450, 457
BfmI CTRYAG 1 cut(s) 66
BisI GCNGC 3 cut(s) 53, 159, 373
BlsI GCNGC 3 cut(s) 54, 160, 374
Bme1390I CCNGG 1 cut(s) 443
Bme18I GGWCC 1 cut(s) 453
BmeRI GACNNNNNGTC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 453
BmrFI CCNGG 1 cut(s) 443
BmsI GCATC 2 cut(s) 265, 314
BpmI CTGGAG 1 cut(s) 342
Bsa29I ATCGAT 1 cut(s) 78
BsaBI GATNNNNATC 1 cut(s) 42
BsaI GGTCTC 2 cut(s) 77, 204
BsaJI CCNNGG 1 cut(s) 442
BsaXI ACNNNNNCTCC 2 cut(s) 389, 419
Bse1I ACTGG 1 cut(s) 241
Bse3DI GCAATG 2 cut(s) 47, 312
Bse8I GATNNNNATC 1 cut(s) 42
BseBI CCWGG 1 cut(s) 443
BseCI ATCGAT 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 442
BseGI GGATG 2 cut(s) 43, 232
BseJI GATNNNNATC 1 cut(s) 42
BseMI GCAATG 2 cut(s) 47, 312
BseNI ACTGG 1 cut(s) 241
BseXI GCAGC 3 cut(s) 64, 145, 359
BshFI GGCC 1 cut(s) 84
BshVI ATCGAT 1 cut(s) 78
BsmAI GTCTC 2 cut(s) 77, 204
BsnI GGCC 1 cut(s) 84
Bso31I GGTCTC 2 cut(s) 77, 204
Bsp143I GATC 1 cut(s) 365
BspACI CCGC 1 cut(s) 303
BspANI GGCC 1 cut(s) 84
BspDI ATCGAT 1 cut(s) 78
BspHI TCATGA 1 cut(s) 268
BspTNI GGTCTC 2 cut(s) 77, 204
BsrDI GCAATG 2 cut(s) 47, 312
BsrI ACTGG 1 cut(s) 241
BssECI CCNNGG 1 cut(s) 442
BssMI GATC 1 cut(s) 365
Bst2UI CCWGG 1 cut(s) 443
Bst4CI ACNGT 1 cut(s) 176
BstF5I GGATG 2 cut(s) 43, 232
BstKTI GATC 1 cut(s) 368
BstMAI GTCTC 2 cut(s) 77, 204
BstMBI GATC 1 cut(s) 365
BstNI CCWGG 1 cut(s) 443
BstSCI CCNGG 1 cut(s) 441
BstSFI CTRYAG 1 cut(s) 66
BstV1I GCAGC 3 cut(s) 64, 145, 359
Bsu15I ATCGAT 1 cut(s) 78
BsuRI GGCC 1 cut(s) 84
BsuTUI ATCGAT 1 cut(s) 78
BtsCI GGATG 2 cut(s) 43, 232
BtsI GCAGTG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 187
CciI TCATGA 1 cut(s) 268
Cfr13I GGNCC 1 cut(s) 453
ClaI ATCGAT 1 cut(s) 78
CspCI CAANNNNNGTGG 2 cut(s) 210, 245
CviAII CATG 3 cut(s) 134, 269, 433
CviJI RGCY 4 cut(s) 84, 158, 336, 425
CviKI_1 RGCY 4 cut(s) 84, 158, 336, 425
DpnI GATC 1 cut(s) 367
DpnII GATC 1 cut(s) 365
DriI GACNNNNNGTC 1 cut(s) 69
EaeI YGGCCR 1 cut(s) 82
Eam1105I GACNNNNNGTC 1 cut(s) 69
Eco31I GGTCTC 2 cut(s) 77, 204
Eco47I GGWCC 1 cut(s) 453
EcoO109I RGGNCCY 1 cut(s) 453
EcoRII CCWGG 1 cut(s) 441
FaeI CATG 3 cut(s) 137, 272, 436
FaiI YATR 6 cut(s) 135, 141, 270, 293, 413, 434
FatI CATG 3 cut(s) 133, 268, 432
Fnu4HI GCNGC 3 cut(s) 53, 159, 373
FokI GGATG 2 cut(s) 30, 239
Fsp4HI GCNGC 3 cut(s) 53, 159, 373
FspBI CTAG 3 cut(s) 203, 450, 457
GluI GCNGC 3 cut(s) 53, 159, 373
GsuI CTGGAG 1 cut(s) 342
HaeIII GGCC 1 cut(s) 84
Hin1II CATG 3 cut(s) 137, 272, 436
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HinfI GANTC 2 cut(s) 146, 428
Hpy166II GTNNAC 2 cut(s) 107, 172
Hpy188I TCNGA 1 cut(s) 409
Hpy188III TCNNGA 6 cut(s) 203, 257, 269, 321, 349, 395
Hpy8I GTNNAC 2 cut(s) 107, 172
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 6 cut(s) 52, 137, 153, 221, 278, 375
Hsp92II CATG 3 cut(s) 137, 272, 436
Kzo9I GATC 1 cut(s) 365
Lsp1109I GCAGC 3 cut(s) 64, 145, 359
LweI GCATC 2 cut(s) 265, 314
MaeI CTAG 3 cut(s) 203, 450, 457
MaeIII GTNAC 1 cut(s) 61
MalI GATC 1 cut(s) 367
MboI GATC 1 cut(s) 365
MlsI TGGCCA 1 cut(s) 84
MluCI AATT 4 cut(s) 20, 56, 213, 376
MluNI TGGCCA 1 cut(s) 84
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 3 cut(s) 44, 326, 328
Mox20I TGGCCA 1 cut(s) 84
MscI TGGCCA 1 cut(s) 84
MseI TTAA 2 cut(s) 342, 384
MslI CAYNNNNRTG 1 cut(s) 273
Msp20I TGGCCA 1 cut(s) 84
MspA1I CMGCKG 1 cut(s) 425
MspR9I CCNGG 1 cut(s) 443
MvaI CCWGG 1 cut(s) 443
NdeII GATC 1 cut(s) 365
NlaIII CATG 3 cut(s) 137, 272, 436
NmuCI GTSAC 1 cut(s) 61
PagI TCATGA 1 cut(s) 268
PfeI GAWTC 2 cut(s) 146, 428
PflFI GACNNNGTC 1 cut(s) 196
PkrI GCNGC 3 cut(s) 54, 160, 374
PpuMI RGGWCCY 1 cut(s) 453
PsiI TTATAA 1 cut(s) 293
Psp5II RGGWCCY 1 cut(s) 453
Psp6I CCWGG 1 cut(s) 441
PspGI CCWGG 1 cut(s) 441
PspPI GGNCC 1 cut(s) 453
PspPPI RGGWCCY 1 cut(s) 453
PsyI GACNNNGTC 1 cut(s) 196
PvuII CAGCTG 1 cut(s) 425
RseI CAYNNNNRTG 1 cut(s) 273
SaqAI TTAA 2 cut(s) 342, 384
SatI GCNGC 3 cut(s) 53, 159, 373
Sau3AI GATC 1 cut(s) 365
Sau96I GGNCC 1 cut(s) 453
ScrFI CCNGG 1 cut(s) 443
SetI ASST 8 cut(s) 36, 73, 90, 115, 160, 348, 427, 455
SfaNI GCATC 2 cut(s) 265, 314
SfcI CTRYAG 1 cut(s) 66
SinI GGWCC 1 cut(s) 453
SmiMI CAYNNNNRTG 1 cut(s) 273
Sse9I AATT 4 cut(s) 20, 56, 213, 376
SsiI CCGC 1 cut(s) 303
SspMI CTAG 3 cut(s) 203, 450, 457
StyD4I CCNGG 1 cut(s) 441
TaaI ACNGT 1 cut(s) 176
TaqI TCGA 2 cut(s) 36, 78
TasI AATT 4 cut(s) 20, 56, 213, 376
TfiI GAWTC 2 cut(s) 146, 428
Tru1I TTAA 2 cut(s) 342, 384
Tru9I TTAA 2 cut(s) 342, 384
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 61
TseI GCWGC 3 cut(s) 52, 158, 372
Tsp45I GTSAC 1 cut(s) 61
TspDTI ATGAA 4 cut(s) 32, 84, 122, 449
TspGWI ACGGA 1 cut(s) 239
TspRI CASTG 1 cut(s) 187
Tth111I GACNNNGTC 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 453
XbaI TCTAGA 1 cut(s) 202
XcmI CCANNNNNNNNNTGG 1 cut(s) 439
XspI CTAG 3 cut(s) 203, 450, 457
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.