Rh7AG489700

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
68984280 .. 68991185
6906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG489700.1

Sequence Viewer

Length: 297 bp
ATGACCTCCATGATAGTCCACCAAACCAACAACGCAGATGAAAACAAAACAGAGGTGATACTCTGTGAAAATAATTCCCAAAAGGTTGAGGAAGAATCGGTGGAAGTAAATCTTAGGGATGCAATCAATAGACTTATAAACTTGACCGCATCTACCATTGCCTTTGGAGATGATGAAGGTTGTATTAAGGAGGATTACATCTCCGACATGACTTTTTCAGCTGATTCCATGAAACTCCTGGGAACTAGGGTGGCATTCTTGTGCTGGAACCTCAACCCTGGAAGTCTTGTGATATAA

Protein Analysis

98

Amino Acids

10.9

Weight (kDa)

4.29

Isoelectric Point (pI)

29.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 137
AciI CCGC 1 cut(s) 147
AjnI CCWGG 2 cut(s) 237, 277
AluBI AGCT 1 cut(s) 221
AluI AGCT 1 cut(s) 221
AsuHPI GGTGA 1 cut(s) 67
BciT130I CCWGG 2 cut(s) 239, 279
BfaI CTAG 1 cut(s) 246
Bme1390I CCNGG 2 cut(s) 239, 279
BmiI GGNNCC 1 cut(s) 269
BmrFI CCNGG 2 cut(s) 239, 279
BmsI GCATC 2 cut(s) 109, 158
BsaJI CCNNGG 2 cut(s) 238, 277
Bse3DI GCAATG 1 cut(s) 156
BseBI CCWGG 2 cut(s) 239, 279
BseDI CCNNGG 2 cut(s) 238, 277
BseGI GGATG 1 cut(s) 124
BseMI GCAATG 1 cut(s) 156
BsmI GAATGC 1 cut(s) 254
BspACI CCGC 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 269
BsrDI GCAATG 1 cut(s) 156
BssECI CCNNGG 2 cut(s) 238, 277
Bst2UI CCWGG 2 cut(s) 239, 279
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 124
BstNI CCWGG 2 cut(s) 239, 279
BstSCI CCNGG 2 cut(s) 237, 277
BtsCI GGATG 1 cut(s) 124
CviAII CATG 3 cut(s) 10, 208, 229
CviJI RGCY 1 cut(s) 221
CviKI_1 RGCY 1 cut(s) 221
DdeI CTNAG 1 cut(s) 113
EcoRII CCWGG 2 cut(s) 237, 277
FaeI CATG 3 cut(s) 13, 211, 232
FaiI YATR 5 cut(s) 11, 137, 209, 230, 295
FalI AAGNNNNNCTT 2 cut(s) 96, 128
FatI CATG 3 cut(s) 9, 207, 228
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 246
Hin1II CATG 3 cut(s) 13, 211, 232
HinfI GANTC 2 cut(s) 95, 224
HphI GGTGA 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 205
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 170
HpyCH4V TGCA 1 cut(s) 122
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 3 cut(s) 13, 211, 232
LpnPI CCDG 5 cut(s) 224, 250, 251, 264, 291
LweI GCATC 2 cut(s) 109, 158
MaeI CTAG 1 cut(s) 246
MboII GAAGA 1 cut(s) 104
MluCI AATT 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 5 cut(s) 16, 46, 82, 184, 281
MseI TTAA 1 cut(s) 186
MslI CAYNNNNRTG 1 cut(s) 259
MspA1I CMGCKG 1 cut(s) 221
MspR9I CCNGG 2 cut(s) 239, 279
Mva1269I GAATGC 1 cut(s) 254
MvaI CCWGG 2 cut(s) 239, 279
NlaIII CATG 3 cut(s) 13, 211, 232
NlaIV GGNNCC 1 cut(s) 269
PctI GAATGC 1 cut(s) 254
PfeI GAWTC 2 cut(s) 95, 224
PsiI TTATAA 1 cut(s) 137
Psp6I CCWGG 2 cut(s) 237, 277
PspGI CCWGG 2 cut(s) 237, 277
PspN4I GGNNCC 1 cut(s) 269
PvuII CAGCTG 1 cut(s) 221
RseI CAYNNNNRTG 1 cut(s) 259
SaqAI TTAA 1 cut(s) 186
ScrFI CCNGG 2 cut(s) 239, 279
SetI ASST 6 cut(s) 8, 57, 87, 181, 223, 273
SfaNI GCATC 2 cut(s) 109, 158
SmiMI CAYNNNNRTG 1 cut(s) 259
Sse9I AATT 1 cut(s) 73
SsiI CCGC 1 cut(s) 147
SspMI CTAG 1 cut(s) 246
StyD4I CCNGG 2 cut(s) 237, 277
TasI AATT 1 cut(s) 73
TfiI GAWTC 2 cut(s) 95, 224
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TspDTI ATGAA 3 cut(s) 54, 189, 245
XcmI CCANNNNNNNNNTGG 1 cut(s) 235
XspI CTAG 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.