RchiOBHm_Chr5g0032921

60S ribosomal protein L18a-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
26733325 .. 26735103
1779 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31205

Sequence Viewer

Length: 258 bp
ATGATCCGTTATGTTGTTGTTAAGGGAAGGCCTGTGAGGGAACGAAGGCTTCCGTGCTGTGGTCTTGGAAGCGGCTGGTTATTGTTTATAATGGGGTTCTTTCTTGGTGGCATCCCCTGGTATATTGGAACTTTTATTTTACTTTGTGTGAGGGTGGACTACAGAGAAAAACCTGGATATGTTGCATGCACATTAGCATCAATTATTGCAGTGCTAGCTATCACTCTTGGCGTTACAAAGCGAACTCACAACTGGTGA

Protein Analysis

85

Amino Acids

9.6

Weight (kDa)

9.96

Isoelectric Point (pI)

32.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 89
AciI CCGC 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 59
AjnI CCWGG 2 cut(s) 116, 172
AluBI AGCT 1 cut(s) 218
AluI AGCT 1 cut(s) 218
AoxI GGCC 1 cut(s) 29
AsuNHI GCTAGC 1 cut(s) 214
BciT130I CCWGG 2 cut(s) 118, 174
BfaI CTAG 1 cut(s) 215
BfmI CTRYAG 1 cut(s) 160
BisI GCNGC 1 cut(s) 73
BlsI GCNGC 1 cut(s) 74
Bme1390I CCNGG 2 cut(s) 118, 174
BmrFI CCNGG 2 cut(s) 118, 174
BmsI GCATC 2 cut(s) 120, 206
BmtI GCTAGC 1 cut(s) 218
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 257
BseBI CCWGG 2 cut(s) 118, 174
BseDI CCNNGG 1 cut(s) 116
BseGI GGATG 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 257
BshFI GGCC 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 59
BsnI GGCC 1 cut(s) 31
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 1 cut(s) 72
BspANI GGCC 1 cut(s) 31
BspOI GCTAGC 1 cut(s) 218
BsrI ACTGG 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 116
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 2 cut(s) 118, 174
BstC8I GCNNGC 2 cut(s) 187, 216
BstF5I GGATG 1 cut(s) 111
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 2 cut(s) 118, 174
BstNSI RCATGY 1 cut(s) 189
BstSCI CCNGG 2 cut(s) 116, 172
BstSFI CTRYAG 1 cut(s) 160
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 111
BtsI GCAGTG 1 cut(s) 216
BtsIMutI CAGTG 1 cut(s) 216
Cac8I GCNNGC 2 cut(s) 187, 216
CviAII CATG 1 cut(s) 186
CviJI RGCY 4 cut(s) 31, 49, 75, 218
CviKI_1 RGCY 4 cut(s) 31, 49, 75, 218
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco147I AGGCCT 1 cut(s) 31
EcoRII CCWGG 2 cut(s) 116, 172
FaeI CATG 1 cut(s) 189
FaiI YATR 5 cut(s) 12, 89, 123, 180, 187
FatI CATG 1 cut(s) 185
Fnu4HI GCNGC 1 cut(s) 73
FokI GGATG 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 73
FspBI CTAG 1 cut(s) 215
GluI GCNGC 1 cut(s) 73
HaeIII GGCC 1 cut(s) 31
Hin1II CATG 1 cut(s) 189
Hpy166II GTNNAC 1 cut(s) 157
Hpy8I GTNNAC 1 cut(s) 157
HpyAV CCTTC 2 cut(s) 21, 39
HpyCH4V TGCA 3 cut(s) 185, 189, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
Hsp92II CATG 1 cut(s) 189
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 7 cut(s) 45, 61, 103, 130, 159, 186, 238
LweI GCATC 2 cut(s) 120, 206
MaeI CTAG 1 cut(s) 215
MaeIII GTNAC 1 cut(s) 232
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MluCI AATT 1 cut(s) 201
MnlI CCTC 2 cut(s) 30, 144
MseI TTAA 1 cut(s) 21
MspR9I CCNGG 2 cut(s) 118, 174
MvaI CCWGG 2 cut(s) 118, 174
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 1 cut(s) 3
NheI GCTAGC 1 cut(s) 214
NlaIII CATG 1 cut(s) 189
NspI RCATGY 1 cut(s) 189
PaeI GCATGC 1 cut(s) 189
PceI AGGCCT 1 cut(s) 31
PkrI GCNGC 1 cut(s) 74
PsiI TTATAA 1 cut(s) 89
Psp6I CCWGG 2 cut(s) 116, 172
PspGI CCWGG 2 cut(s) 116, 172
SaqAI TTAA 1 cut(s) 21
SatI GCNGC 1 cut(s) 73
Sau3AI GATC 1 cut(s) 3
ScrFI CCNGG 2 cut(s) 118, 174
SetI ASST 2 cut(s) 175, 220
SfaNI GCATC 2 cut(s) 120, 206
SfcI CTRYAG 1 cut(s) 160
SphI GCATGC 1 cut(s) 189
Sse9I AATT 1 cut(s) 201
SseBI AGGCCT 1 cut(s) 31
SsiI CCGC 1 cut(s) 72
SspMI CTAG 1 cut(s) 215
StuI AGGCCT 1 cut(s) 31
StyD4I CCNGG 2 cut(s) 116, 172
TasI AATT 1 cut(s) 201
TauI GCSGC 1 cut(s) 75
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TscAI CASTG 1 cut(s) 216
TspGWI ACGGA 1 cut(s) 42
TspRI CASTG 1 cut(s) 216
XceI RCATGY 1 cut(s) 189
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.