Rroxscaffold_1G00062850

60S ribosomal protein L18a-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
84907508 .. 84909760
2253 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00062850.1

Sequence Viewer

Length: 168 bp
ATGGGGTTCTTTTTTGGTGGCATCCCCTGGTATATTGGAACTTTTATTTTACTTTGTGTGAGGGTGGACTACAGAGAAAAACCTGGATATGTTGCATGCACATTAGCTTCAATTATTGCGGTGCTAGCTATCACTCTTGGCGTTACAAAGCGAACTCACAACTGGTGA

Protein Analysis

55

Amino Acids

6.18

Weight (kDa)

9.24

Isoelectric Point (pI)

24.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 119
AgsI TTSAA 1 cut(s) 111
AjnI CCWGG 2 cut(s) 26, 82
AluBI AGCT 2 cut(s) 107, 128
AluI AGCT 2 cut(s) 107, 128
AsuNHI GCTAGC 1 cut(s) 124
BciT130I CCWGG 2 cut(s) 28, 84
BfaI CTAG 1 cut(s) 125
BfmI CTRYAG 1 cut(s) 70
Bme1390I CCNGG 2 cut(s) 28, 84
BmrFI CCNGG 2 cut(s) 28, 84
BmsI GCATC 1 cut(s) 30
BmtI GCTAGC 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 167
BseBI CCWGG 2 cut(s) 28, 84
BseDI CCNNGG 1 cut(s) 26
BseGI GGATG 1 cut(s) 21
BseNI ACTGG 1 cut(s) 167
BspACI CCGC 1 cut(s) 119
BspOI GCTAGC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 26
Bst2UI CCWGG 2 cut(s) 28, 84
BstC8I GCNNGC 2 cut(s) 97, 126
BstF5I GGATG 1 cut(s) 21
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstNI CCWGG 2 cut(s) 28, 84
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 2 cut(s) 26, 82
BstSFI CTRYAG 1 cut(s) 70
BtsCI GGATG 1 cut(s) 21
Cac8I GCNNGC 2 cut(s) 97, 126
CviAII CATG 1 cut(s) 96
CviJI RGCY 2 cut(s) 107, 128
CviKI_1 RGCY 2 cut(s) 107, 128
EcoRII CCWGG 2 cut(s) 26, 82
FaeI CATG 1 cut(s) 99
FaiI YATR 3 cut(s) 33, 90, 97
FatI CATG 1 cut(s) 95
FokI GGATG 1 cut(s) 8
FspBI CTAG 1 cut(s) 125
Hin1II CATG 1 cut(s) 99
Hpy166II GTNNAC 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 67
HpyCH4V TGCA 2 cut(s) 95, 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
Hsp92II CATG 1 cut(s) 99
LpnPI CCDG 5 cut(s) 13, 40, 69, 96, 148
LweI GCATC 1 cut(s) 30
MaeI CTAG 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 142
MluCI AATT 1 cut(s) 111
MnlI CCTC 1 cut(s) 54
MspR9I CCNGG 2 cut(s) 28, 84
MvaI CCWGG 2 cut(s) 28, 84
MwoI GCNNNNNNNGC 1 cut(s) 125
NheI GCTAGC 1 cut(s) 124
NlaIII CATG 1 cut(s) 99
NspI RCATGY 1 cut(s) 99
PaeI GCATGC 1 cut(s) 99
Psp6I CCWGG 2 cut(s) 26, 82
PspGI CCWGG 2 cut(s) 26, 82
ScrFI CCNGG 2 cut(s) 28, 84
SetI ASST 3 cut(s) 85, 109, 130
SfaNI GCATC 1 cut(s) 30
SfcI CTRYAG 1 cut(s) 70
SgeI CNNG 7 cut(s) 39, 40, 95, 96, 108, 137, 149
SphI GCATGC 1 cut(s) 99
Sse9I AATT 1 cut(s) 111
SsiI CCGC 1 cut(s) 119
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 2 cut(s) 26, 82
TasI AATT 1 cut(s) 111
XceI RCATGY 1 cut(s) 99
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.