RchiOBHm_Chr6g0245721

Glutathione peroxidase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
1503337 .. 1503906
570 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22023

Sequence Viewer

Length: 207 bp
ATGTTCTTTTATCTCAATTTTGAGAATGATGTGGATCATAACGTTTACAAGAGAAAAGTTCTGCTCATTGTCAAAGTTGCTTCCAAATGTGGACTAACAAACTCAAACTACACGGAGCTGAATCAACTATATGAAAAGTATAAAGATCAAGGTTTGAATTTTGAACTACTATTGTTCTTTGATGCCTATCATTTTGAGGACCGTTGA

Protein Analysis

68

Amino Acids

8.27

Weight (kDa)

5.53

Isoelectric Point (pI)

12.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GSHPx PF00255 9 - 53 1.6e-12 Glutathione peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 42
AclWI GGATC 1 cut(s) 42
AcsI RAATTY 1 cut(s) 157
AgsI TTSAA 2 cut(s) 157, 164
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
AlwI GGATC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 157
AspS9I GGNCC 1 cut(s) 199
AvaII GGWCC 1 cut(s) 199
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
BmsI GCATC 1 cut(s) 172
BsaBI GATNNNNATC 2 cut(s) 33, 186
Bse8I GATNNNNATC 2 cut(s) 33, 186
BseJI GATNNNNATC 2 cut(s) 33, 186
Bsp143I GATC 2 cut(s) 34, 145
BspPI GGATC 1 cut(s) 42
BssMI GATC 2 cut(s) 34, 145
Bst4CI ACNGT 1 cut(s) 203
BstKTI GATC 2 cut(s) 37, 148
BstMBI GATC 2 cut(s) 34, 145
Cfr13I GGNCC 1 cut(s) 199
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
DpnI GATC 2 cut(s) 36, 147
DpnII GATC 2 cut(s) 34, 145
Eco47I GGWCC 1 cut(s) 199
FaiI YATR 4 cut(s) 39, 130, 132, 141
FspEI CC 7 cut(s) 17, 75, 97, 98, 135, 182, 199
HinfI GANTC 1 cut(s) 121
Hpy166II GTNNAC 2 cut(s) 46, 92
Hpy8I GTNNAC 2 cut(s) 46, 92
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4IV ACGT 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 42
Kzo9I GATC 2 cut(s) 34, 145
LmnI GCTCC 1 cut(s) 115
LweI GCATC 1 cut(s) 172
MaeII ACGT 1 cut(s) 42
MalI GATC 2 cut(s) 36, 147
MboI GATC 2 cut(s) 34, 145
MluCI AATT 2 cut(s) 16, 157
MnlI CCTC 1 cut(s) 190
NdeII GATC 2 cut(s) 34, 145
PfeI GAWTC 1 cut(s) 121
Psp1406I AACGTT 1 cut(s) 42
PspPI GGNCC 1 cut(s) 199
Sau3AI GATC 2 cut(s) 34, 145
Sau96I GGNCC 1 cut(s) 199
SetI ASST 3 cut(s) 45, 120, 154
SfaNI GCATC 1 cut(s) 172
SgeI CNNG 3 cut(s) 61, 124, 161
SinI GGWCC 1 cut(s) 199
Sse9I AATT 2 cut(s) 16, 157
TaaI ACNGT 1 cut(s) 203
TaiI ACGT 1 cut(s) 45
TasI AATT 2 cut(s) 16, 157
TfiI GAWTC 1 cut(s) 121
TspDTI ATGAA 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.