RchiOBHm_Chr6g0246441

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
2142609 .. 2145765
3157 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22089

Sequence Viewer

Length: 300 bp
ATGAGCATACAGAGAATCTCTACATCTATCCCCCCTTTAACTCCTCAGTGGAAATATGATGTTTTTCTGAGCTTTAGAGGCGATGACACTCGCAAGGCTTTTACAGACCACTTATACACTGCATTGGAACATCAAGGAATCATAACTTTCAGGGATGATCCTGAACTTCAGAAAGGGAAAGCTATTTCTCCAGAACTTTTTGCTGCAATTGAAGAATCAAGATTTGCTCTCATTGTTCTCTCACAAAATTATGCATCGTCAACATGGTGCTTGGATGACCTTGTAAAAATCCTTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.35

Weight (kDa)

5.06

Isoelectric Point (pI)

44.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TIR PF01582 18 - 99 1.1e-29 TIR domain
TIR_2 PF13676 21 - 96 4.7e-13 TIR domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 152
AcuI CTGAAG 1 cut(s) 152
AgsI TTSAA 2 cut(s) 212, 296
AluBI AGCT 2 cut(s) 72, 182
AluI AGCT 2 cut(s) 72, 182
AlwI GGATC 1 cut(s) 152
ApeKI GCWGC 1 cut(s) 203
BbvI GCAGC 1 cut(s) 190
BisI GCNGC 1 cut(s) 204
BlsI GCNGC 1 cut(s) 205
BmsI GCATC 1 cut(s) 263
BpmI CTGGAG 1 cut(s) 174
BseGI GGATG 2 cut(s) 160, 280
BseMII CTCAG 2 cut(s) 59, 59
BseRI GAGGAG 1 cut(s) 33
BseXI GCAGC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 157
BspCNI CTCAG 2 cut(s) 58, 60
BspPI GGATC 1 cut(s) 152
BssMI GATC 1 cut(s) 157
BstDEI CTNAG 2 cut(s) 45, 68
BstF5I GGATG 2 cut(s) 160, 280
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstMWI GCNNNNNNNGC 1 cut(s) 78
BstV1I GCAGC 1 cut(s) 190
BtgZI GCGATG 1 cut(s) 96
BtsCI GGATG 2 cut(s) 160, 280
BtsI GCAGTG 1 cut(s) 117
BtsIMutI CAGTG 2 cut(s) 53, 117
CviAII CATG 1 cut(s) 264
CviJI RGCY 3 cut(s) 72, 98, 182
CviKI_1 RGCY 3 cut(s) 72, 98, 182
DdeI CTNAG 2 cut(s) 45, 68
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 256
FaeI CATG 1 cut(s) 267
FaiI YATR 6 cut(s) 8, 57, 115, 143, 252, 265
FatI CATG 1 cut(s) 263
Fnu4HI GCNGC 1 cut(s) 204
FokI GGATG 2 cut(s) 167, 287
Fsp4HI GCNGC 1 cut(s) 204
GluI GCNGC 1 cut(s) 204
GsuI CTGGAG 1 cut(s) 174
Hin1II CATG 1 cut(s) 267
HincII GTYRAC 1 cut(s) 261
HindII GTYRAC 1 cut(s) 261
HinfI GANTC 3 cut(s) 15, 138, 215
Hpy166II GTNNAC 1 cut(s) 261
Hpy188I TCNGA 2 cut(s) 69, 171
Hpy188III TCNNGA 3 cut(s) 161, 191, 219
Hpy8I GTNNAC 1 cut(s) 261
HpyCH4V TGCA 3 cut(s) 122, 206, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
HpyF3I CTNAG 2 cut(s) 45, 68
Hsp92II CATG 1 cut(s) 267
Kzo9I GATC 1 cut(s) 157
LpnPI CCDG 3 cut(s) 136, 174, 204
Lsp1109I GCAGC 1 cut(s) 190
LweI GCATC 1 cut(s) 263
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 1 cut(s) 224
MfeI CAATTG 1 cut(s) 207
MluCI AATT 2 cut(s) 207, 247
MnlI CCTC 2 cut(s) 54, 71
Mph1103I ATGCAT 1 cut(s) 256
MseI TTAA 1 cut(s) 38
MunI CAATTG 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 78
NdeII GATC 1 cut(s) 157
NlaIII CATG 1 cut(s) 267
NsiI ATGCAT 1 cut(s) 256
PfeI GAWTC 3 cut(s) 15, 138, 215
PkrI GCNGC 1 cut(s) 205
SaqAI TTAA 1 cut(s) 38
SatI GCNGC 1 cut(s) 204
Sau3AI GATC 1 cut(s) 157
SetI ASST 3 cut(s) 74, 184, 282
SfaNI GCATC 1 cut(s) 263
Sse9I AATT 2 cut(s) 207, 247
TasI AATT 2 cut(s) 207, 247
TfiI GAWTC 3 cut(s) 15, 138, 215
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TscAI CASTG 2 cut(s) 53, 124
TseI GCWGC 1 cut(s) 203
TspRI CASTG 2 cut(s) 53, 124
Zsp2I ATGCAT 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.