Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001066.1

Orthogroup ID

OG0010601

Physical Location & Seq

Genomic Coordinates Reverse (-)

11064 .. 13329

Gene Structure 2266 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001066.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 801 bp

atgagcacacaaagaacctctacatcttaccccccttcaactgctcagtggaaatatgatgtctttctgagctttagaggtgatgacactcgcaaggcttttacagaccacttatacactgcattgaaacatcaaggagtcacaacttttagggatgatcctgaacttcaaaaaggggaagctatttctccagaactttttgctgcaattgaagaatcgagatttgctctcattgttctctcacaaaattatgcatcgtcaacatggtatgaatcaaagctgataagagatattattgaagttatatggaaaaaattgcaacctacatcattcagttatgcagaaaatctagttggaatttattcaagattgcagccagtcaatttgcttttagatgtaggggtggatgacgtccgcttctttggtatatggggaatgggcgggattggtaagactactatggtaagagcagtgtatgagagaatctctcgtgaatttgaatttagtgtccttcttactgatgttagaaactttgttgaaaaaagtggtctacttaatttacaaaagcaacttctctctgggatttggacaaagaaggtcaacatatcagaccttcatgaaggagccatgattataaggaggttgtttggggacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcatttagaatatttggcaggaaacccagagtgcgccttggaggacgcctttcacgcctttcgcgccttggaggacgcctcaccagcgtcgtcgcctaacccctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_3 NB-ARC TIR

Protein Analysis

266

Amino Acids

30.15

Weight (kDa)

5.73

Isoelectric Point (pI)

40.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010601)

Species	Orthologous Gene IDs
malus_domestica	MD01G1189400.v1.1 MD01G1189500.v1.1 MD01G1190900.v1.1 MD02G1115500.v1.1 MD07G1015200.v1.1
prunus_persica	Prupe.7G017000_v2.0.a1
pyrus_communis	pycom01g20170 pycom01g20180
rosa_chinensis	RchiOBHm_Chr1g0375961 RchiOBHm_Chr6g0246441 RchiOBHm_Chr6g0250821
rosa_laevigata	RLG00000002905 RLG00000026640 RLG00000026645 RLG00000028594
rosa_multiflora	Rmu_sc0001066.1_g000002
rosa_roxburghii	Rroxscaffold_4G00305800
rosa_rugosa	Rorug02G0306400 Rorug05G0497800 Rorug07G0269300
rosa_wichuraiana	Rw6G016530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	635
AatII	GACGTC	1 cut(s)	414
AccI	GTMKAC	1 cut(s)	550
AccII	CGCG	1 cut(s)	759
AciI	CCGC	2 cut(s)	415, 441
AclWI	GGATC	1 cut(s)	152
AcsI	RAATTY	3 cut(s)	357, 494, 500
AcyI	GRCGYC	3 cut(s)	411, 741, 771
AgsI	TTSAA	9 cut(s)	39, 127, 170, 212, 299, 366, 500, 539, 693
AjuI	GAANNNNNNNTTGG	2 cut(s)	336, 368
AluBI	AGCT	3 cut(s)	72, 182, 280
AluI	AGCT	3 cut(s)	72, 182, 280
Alw21I	GWGCWC	1 cut(s)	8
AlwI	GGATC	1 cut(s)	152
ApeKI	GCWGC	2 cut(s)	203, 373
ApoI	RAATTY	3 cut(s)	357, 494, 500
Asp700I	GAANNNNTTC	1 cut(s)	361
AspLEI	GCGC	2 cut(s)	731, 761
AsuHPI	GGTGA	2 cut(s)	92, 768
BauI	CACGAG	1 cut(s)	489
Bbv12I	GWGCWC	1 cut(s)	8
BbvI	GCAGC	2 cut(s)	190, 385
BfaI	CTAG	1 cut(s)	350
BisI	GCNGC	2 cut(s)	204, 374
BlsI	GCNGC	2 cut(s)	205, 375
BmiI	GGNNCC	1 cut(s)	625
BmsI	GCATC	1 cut(s)	263
BplI	GAGNNNNNCTC	8 cut(s)	211, 243, 470, 502, 472, 504, 758, 790
BpmI	CTGGAG	1 cut(s)	174
BsaHI	GRCGYC	3 cut(s)	411, 741, 771
BsaJI	CCNNGG	2 cut(s)	732, 762
Bse1I	ACTGG	1 cut(s)	377
BseDI	CCNNGG	2 cut(s)	732, 762
BseGI	GGATG	2 cut(s)	160, 412
BseMII	CTCAG	2 cut(s)	59, 59
BseNI	ACTGG	1 cut(s)	377
BseXI	GCAGC	2 cut(s)	190, 385
Bsh1236I	CGCG	1 cut(s)	759
BsiHKAI	GWGCWC	1 cut(s)	8
BslFI	GGGAC	1 cut(s)	665
BsmFI	GGGAC	1 cut(s)	665
Bsp1286I	GDGCHC	1 cut(s)	8
Bsp143I	GATC	1 cut(s)	157
BspACI	CCGC	2 cut(s)	415, 441
BspCNI	CTCAG	2 cut(s)	58, 60
BspFNI	CGCG	1 cut(s)	759
BspHI	TCATGA	1 cut(s)	616
BspLI	GGNNCC	1 cut(s)	625
BspPI	GGATC	1 cut(s)	152
BsrI	ACTGG	1 cut(s)	377
BssECI	CCNNGG	2 cut(s)	732, 762
BssMI	GATC	1 cut(s)	157
BssNI	GRCGYC	3 cut(s)	411, 741, 771
BssSI	CACGAG	1 cut(s)	489
BssT1I	CCWWGG	2 cut(s)	732, 762
Bst2BI	CACGAG	1 cut(s)	489
BstACI	GRCGYC	3 cut(s)	411, 741, 771
BstDEI	CTNAG	2 cut(s)	45, 68
BstF5I	GGATG	2 cut(s)	160, 412
BstFNI	CGCG	1 cut(s)	759
BstHHI	GCGC	2 cut(s)	731, 761
BstKTI	GATC	1 cut(s)	160
BstMBI	GATC	1 cut(s)	157
BstMWI	GCNNNNNNNGC	3 cut(s)	749, 758, 779
BstUI	CGCG	1 cut(s)	759
BstV1I	GCAGC	2 cut(s)	190, 385
BtsCI	GGATG	2 cut(s)	160, 412
BtsI	GCAGTG	2 cut(s)	117, 477
BtsIMutI	CAGTG	3 cut(s)	53, 117, 477
CciI	TCATGA	1 cut(s)	616
CfoI	GCGC	2 cut(s)	731, 761
CseI	GACGC	3 cut(s)	749, 771, 779
CviAII	CATG	3 cut(s)	264, 617, 628
CviJI	RGCY	6 cut(s)	72, 98, 182, 280, 376, 626
CviKI_1	RGCY	6 cut(s)	72, 98, 182, 280, 376, 626
DdeI	CTNAG	2 cut(s)	45, 68
DpnI	GATC	1 cut(s)	159
DpnII	GATC	1 cut(s)	157
Eco130I	CCWWGG	2 cut(s)	732, 762
EcoT14I	CCWWGG	2 cut(s)	732, 762
EcoT22I	ATGCAT	1 cut(s)	256
ErhI	CCWWGG	2 cut(s)	732, 762
FaeI	CATG	3 cut(s)	267, 620, 631
FaqI	GGGAC	1 cut(s)	665
FatI	CATG	3 cut(s)	263, 616, 627
FauI	CCCGC	1 cut(s)	434
FblI	GTMKAC	1 cut(s)	550
Fnu4HI	GCNGC	2 cut(s)	204, 374
FokI	GGATG	2 cut(s)	167, 419
Fsp4HI	GCNGC	2 cut(s)	204, 374
FspBI	CTAG	1 cut(s)	350
GlaI	GCGC	2 cut(s)	730, 760
GluI	GCNGC	2 cut(s)	204, 374
GsuI	CTGGAG	1 cut(s)	174
HgaI	GACGC	3 cut(s)	749, 771, 779
HhaI	GCGC	2 cut(s)	731, 761
Hin1I	GRCGYC	3 cut(s)	411, 741, 771
Hin1II	CATG	3 cut(s)	267, 620, 631
Hin6I	GCGC	2 cut(s)	729, 759
HinP1I	GCGC	2 cut(s)	729, 759
HincII	GTYRAC	2 cut(s)	261, 601
HindII	GTYRAC	2 cut(s)	261, 601
HinfI	GANTC	4 cut(s)	138, 215, 272, 483
HphI	GGTGA	2 cut(s)	92, 768
Hpy166II	GTNNAC	4 cut(s)	261, 551, 601, 685
Hpy188I	TCNGA	2 cut(s)	69, 610
Hpy188III	TCNNGA	7 cut(s)	161, 191, 219, 366, 491, 617, 674
Hpy8I	GTNNAC	4 cut(s)	261, 551, 601, 685
Hpy99I	CGWCG	2 cut(s)	787, 790
HpyAV	CCTTC	5 cut(s)	45, 521, 589, 614, 623
HpyCH4IV	ACGT	1 cut(s)	411
HpyCH4V	TGCA	6 cut(s)	122, 206, 254, 319, 341, 373
HpyF10VI	GCNNNNNNNGC	3 cut(s)	749, 758, 779
HpyF3I	CTNAG	2 cut(s)	45, 68
HpySE526I	ACGT	1 cut(s)	411
Hsp92I	GRCGYC	3 cut(s)	411, 741, 771
Hsp92II	CATG	3 cut(s)	267, 620, 631
HspAI	GCGC	2 cut(s)	729, 759
Kzo9I	GATC	1 cut(s)	157
LmnI	GCTCC	1 cut(s)	623
LpnPI	CCDG	7 cut(s)	174, 204, 390, 564, 699, 735, 792
Lsp1109I	GCAGC	2 cut(s)	190, 385
LweI	GCATC	1 cut(s)	263
MaeI	CTAG	1 cut(s)	350
MaeII	ACGT	1 cut(s)	411
MaeIII	GTNAC	1 cut(s)	139
MalI	GATC	1 cut(s)	159
MboI	GATC	1 cut(s)	157
MboII	GAAGA	2 cut(s)	224, 656
MfeI	CAATTG	1 cut(s)	207
MhlI	GDGCHC	1 cut(s)	8
MluCI	AATT	8 cut(s)	207, 247, 314, 357, 382, 494, 500, 556
MlyI	GAGTC	1 cut(s)	147
MmeI	TCCRAC	1 cut(s)	334
MnlI	CCTC	6 cut(s)	28, 71, 633, 730, 760, 784
Mph1103I	ATGCAT	1 cut(s)	256
MroXI	GAANNNNTTC	1 cut(s)	361
MseI	TTAA	1 cut(s)	555
MunI	CAATTG	1 cut(s)	207
MvnI	CGCG	1 cut(s)	759
MwoI	GCNNNNNNNGC	3 cut(s)	749, 758, 779
NdeII	GATC	1 cut(s)	157
NlaIII	CATG	3 cut(s)	267, 620, 631
NlaIV	GGNNCC	1 cut(s)	625
NmuCI	GTSAC	1 cut(s)	139
NsiI	ATGCAT	1 cut(s)	256
PagI	TCATGA	1 cut(s)	616
PdmI	GAANNNNTTC	1 cut(s)	361
PfeI	GAWTC	3 cut(s)	215, 272, 483
PkrI	GCNGC	2 cut(s)	205, 375
PleI	GAGTC	1 cut(s)	146
PpsI	GAGTC	1 cut(s)	146
PsiI	TTATAA	1 cut(s)	635
PspN4I	GGNNCC	1 cut(s)	625
SaqAI	TTAA	1 cut(s)	555
SatI	GCNGC	2 cut(s)	204, 374
Sau3AI	GATC	1 cut(s)	157
SchI	GAGTC	1 cut(s)	147
SduI	GDGCHC	1 cut(s)	8
SfaNI	GCATC	1 cut(s)	263
Sse9I	AATT	8 cut(s)	207, 247, 314, 357, 382, 494, 500, 556
SsiI	CCGC	2 cut(s)	415, 441
SspI	AATATT	1 cut(s)	707
SspMI	CTAG	1 cut(s)	350
StyI	CCWWGG	2 cut(s)	732, 762
TaiI	ACGT	1 cut(s)	414
TaqI	TCGA	1 cut(s)	218
TasI	AATT	8 cut(s)	207, 247, 314, 357, 382, 494, 500, 556
TfiI	GAWTC	3 cut(s)	215, 272, 483
Tru1I	TTAA	1 cut(s)	555
Tru9I	TTAA	1 cut(s)	555
TscAI	CASTG	3 cut(s)	53, 124, 477
TseFI	GTSAC	1 cut(s)	139
TseI	GCWGC	2 cut(s)	203, 373
Tsp45I	GTSAC	1 cut(s)	139
TspDTI	ATGAA	3 cut(s)	285, 605, 633
TspRI	CASTG	3 cut(s)	53, 124, 477
XapI	RAATTY	3 cut(s)	357, 494, 500
XmiI	GTMKAC	1 cut(s)	550
XmnI	GAANNNNTTC	1 cut(s)	361
XspI	CTAG	1 cut(s)	350
ZraI	GACGTC	1 cut(s)	412
Zsp2I	ATGCAT	1 cut(s)	256

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.