RchiOBHm_Chr6g0267921

L-ascorbate oxidase homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
24723383 .. 24726078
2696 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24031

Sequence Viewer

Length: 150 bp
ATGTATGGTGGAGAGTGGACACCAGCAAGCAAATTAAGATATAATATGCAGAACGCTATTTTCTGTTGCACTGTTCAGGTCCATCCTAATTCATGGACTGAAATTTACGCCAGATCTGGACAATGTGGGAATGTGGAATGTGAGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.59

Weight (kDa)

5.55

Isoelectric Point (pI)

43.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 102
ApoI RAATTY 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 79
AvaII GGWCC 1 cut(s) 79
BccI CCATC 1 cut(s) 90
BglII AGATCT 2 cut(s) 113, 144
Bme18I GGWCC 1 cut(s) 79
BmgT120I GGNCC 1 cut(s) 79
BseGI GGATG 1 cut(s) 82
Bsp143I GATC 2 cut(s) 113, 144
BssMI GATC 2 cut(s) 113, 144
Bst4CI ACNGT 1 cut(s) 73
BstC8I GCNNGC 1 cut(s) 28
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 2 cut(s) 116, 147
BstMBI GATC 2 cut(s) 113, 144
BstX2I RGATCY 2 cut(s) 113, 144
BstYI RGATCY 2 cut(s) 113, 144
BtsCI GGATG 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 79
CviAII CATG 1 cut(s) 93
DpnI GATC 2 cut(s) 115, 146
DpnII GATC 2 cut(s) 113, 144
Eco47I GGWCC 1 cut(s) 79
FaeI CATG 1 cut(s) 96
FaiI YATR 4 cut(s) 6, 42, 47, 94
FatI CATG 1 cut(s) 92
FokI GGATG 1 cut(s) 69
Hin1II CATG 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 1 cut(s) 149
Hpy188III TCNNGA 1 cut(s) 117
Hpy8I GTNNAC 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 49, 69
Hsp92II CATG 1 cut(s) 96
Kzo9I GATC 2 cut(s) 113, 144
LpnPI CCDG 4 cut(s) 36, 62, 102, 124
MalI GATC 2 cut(s) 115, 146
MboI GATC 2 cut(s) 113, 144
MflI RGATCY 2 cut(s) 113, 144
MluCI AATT 3 cut(s) 32, 88, 102
MseI TTAA 1 cut(s) 35
NdeII GATC 2 cut(s) 113, 144
NlaIII CATG 1 cut(s) 96
PspPI GGNCC 1 cut(s) 79
PsuI RGATCY 2 cut(s) 113, 144
SaqAI TTAA 1 cut(s) 35
Sau3AI GATC 2 cut(s) 113, 144
Sau96I GGNCC 1 cut(s) 79
SetI ASST 1 cut(s) 81
SgeI CNNG 6 cut(s) 35, 39, 89, 105, 123, 129
SinI GGWCC 1 cut(s) 79
Sse9I AATT 3 cut(s) 32, 88, 102
TaaI ACNGT 1 cut(s) 73
TasI AATT 3 cut(s) 32, 88, 102
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TscAI CASTG 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 81
TspRI CASTG 1 cut(s) 76
VpaK11BI GGWCC 1 cut(s) 79
XapI RAATTY 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.