Rh1CG188100

L-ascorbate oxidase homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
41011643 .. 41013341
1699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG188100.1

Sequence Viewer

Length: 324 bp
ATGAACCATATTGAGATAGTCAGATACAGTACGTCTTTCTTTATAACAATATGTGAAACAACTTCAGTTGCAAAGCTTAAGCATAACTATTTCACTGAAAAAGGTGGGGTCATTAAGAAGTTATCGAACAAAAAGGGGAAGCGTGCTCCTCCATCATTTTGGGAGCTCAGCAGTATGTATGGTGGAGAGTGGACACCAGCAAGCAAATTAAGATATAATATGCAGAACGCTATTTTCTGTTGCACTGTTCAGGTCCATCCTAATTCATGGACTGAAATTTACGCCAGATCTGGACAATGTGGGAATGTGGAATGTGAGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.22

Weight (kDa)

9.04

Isoelectric Point (pI)

45.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 44
AcsI RAATTY 1 cut(s) 276
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 31
AflII CTTAAG 1 cut(s) 77
AluBI AGCT 2 cut(s) 76, 166
AluI AGCT 2 cut(s) 76, 166
Alw21I GWGCWC 2 cut(s) 148, 168
ApoI RAATTY 1 cut(s) 276
AspS9I GGNCC 1 cut(s) 253
AvaII GGWCC 1 cut(s) 253
BanII GRGCYC 1 cut(s) 168
Bbv12I GWGCWC 2 cut(s) 148, 168
BccI CCATC 2 cut(s) 160, 264
BfrI CTTAAG 1 cut(s) 77
BglII AGATCT 2 cut(s) 287, 318
BlpI GCTNAGC 1 cut(s) 167
Bme18I GGWCC 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 253
Bpu1102I GCTNAGC 1 cut(s) 167
BseGI GGATG 1 cut(s) 256
BseMII CTCAG 1 cut(s) 181
BseRI GAGGAG 1 cut(s) 138
BsiHKAI GWGCWC 2 cut(s) 148, 168
Bsp1286I GDGCHC 2 cut(s) 148, 168
Bsp143I GATC 2 cut(s) 287, 318
Bsp1720I GCTNAGC 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 180
BspTI CTTAAG 1 cut(s) 77
BssMI GATC 2 cut(s) 287, 318
Bst4CI ACNGT 2 cut(s) 29, 247
BstAFI CTTAAG 1 cut(s) 77
BstC8I GCNNGC 2 cut(s) 144, 202
BstDEI CTNAG 1 cut(s) 167
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 2 cut(s) 290, 321
BstMBI GATC 2 cut(s) 287, 318
BstX2I RGATCY 2 cut(s) 287, 318
BstXI CCANNNNNNTGG 1 cut(s) 159
BstYI RGATCY 2 cut(s) 287, 318
BtsCI GGATG 1 cut(s) 256
BtsIMutI CAGTG 2 cut(s) 93, 243
Cac8I GCNNGC 2 cut(s) 144, 202
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 30
CviAII CATG 1 cut(s) 267
CviJI RGCY 2 cut(s) 76, 166
CviKI_1 RGCY 2 cut(s) 76, 166
CviQI GTAC 1 cut(s) 30
DdeI CTNAG 1 cut(s) 167
DpnI GATC 2 cut(s) 289, 320
DpnII GATC 2 cut(s) 287, 318
Ecl136II GAGCTC 1 cut(s) 166
Eco24I GRGCYC 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 253
Eco53kI GAGCTC 1 cut(s) 166
Eco57I CTGAAG 1 cut(s) 48
EcoICRI GAGCTC 1 cut(s) 166
EcoT38I GRGCYC 1 cut(s) 168
FaeI CATG 1 cut(s) 270
FaiI YATR 9 cut(s) 9, 44, 52, 84, 176, 180, 216, 221, 268
FatI CATG 1 cut(s) 266
FokI GGATG 1 cut(s) 243
FriOI GRGCYC 1 cut(s) 168
Hin1II CATG 1 cut(s) 270
HindIII AAGCTT 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 2 cut(s) 23, 323
Hpy188III TCNNGA 1 cut(s) 291
Hpy8I GTNNAC 1 cut(s) 192
HpyCH4III ACNGT 2 cut(s) 29, 247
HpyCH4IV ACGT 1 cut(s) 32
HpyCH4V TGCA 3 cut(s) 71, 223, 243
HpyF3I CTNAG 1 cut(s) 167
HpySE526I ACGT 1 cut(s) 32
Hsp92II CATG 1 cut(s) 270
Kzo9I GATC 2 cut(s) 287, 318
LmnI GCTCC 2 cut(s) 151, 163
LpnPI CCDG 4 cut(s) 210, 236, 276, 298
MaeII ACGT 1 cut(s) 32
MalI GATC 2 cut(s) 289, 320
MboI GATC 2 cut(s) 287, 318
MflI RGATCY 2 cut(s) 287, 318
MhlI GDGCHC 2 cut(s) 148, 168
MluCI AATT 3 cut(s) 206, 262, 276
MnlI CCTC 1 cut(s) 159
MseI TTAA 3 cut(s) 78, 114, 209
MspCI CTTAAG 1 cut(s) 77
NdeII GATC 2 cut(s) 287, 318
NlaIII CATG 1 cut(s) 270
PsiI TTATAA 1 cut(s) 44
Psp124BI GAGCTC 1 cut(s) 168
PspPI GGNCC 1 cut(s) 253
PsuI RGATCY 2 cut(s) 287, 318
RsaI GTAC 1 cut(s) 31
RsaNI GTAC 1 cut(s) 30
SacI GAGCTC 1 cut(s) 168
SaqAI TTAA 3 cut(s) 78, 114, 209
Sau3AI GATC 2 cut(s) 287, 318
Sau96I GGNCC 1 cut(s) 253
SduI GDGCHC 2 cut(s) 148, 168
SetI ASST 5 cut(s) 35, 78, 106, 168, 255
SgeI CNNG 7 cut(s) 155, 209, 213, 263, 279, 297, 303
SinI GGWCC 1 cut(s) 253
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 3 cut(s) 206, 262, 276
SstI GAGCTC 1 cut(s) 168
TaaI ACNGT 2 cut(s) 29, 247
TaiI ACGT 1 cut(s) 35
TaqI TCGA 1 cut(s) 125
TasI AATT 3 cut(s) 206, 262, 276
Tru1I TTAA 3 cut(s) 78, 114, 209
Tru9I TTAA 3 cut(s) 78, 114, 209
TscAI CASTG 2 cut(s) 100, 250
TspDTI ATGAA 2 cut(s) 17, 255
TspRI CASTG 2 cut(s) 100, 250
Vha464I CTTAAG 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 253
XapI RAATTY 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.