RchiOBHm_Chr7g0224431

synthase 3

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
46570157 .. 46575643
5487 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20096

Sequence Viewer

Length: 132 bp
ATGATAAATGGATGCTCATGGATTGAATTACAACCACTCACTAGCCGAAAGCATCAGGTTGTCTTGCAATTGGCTACTATTTGGTTGGAGCACAAGGATTCTTTAGCTGCAATAGAGAGGAGGCGAGAGTAA

Protein Analysis

43

Amino Acids

5.07

Weight (kDa)

8.0

Isoelectric Point (pI)

86.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
Alw21I GWGCWC 1 cut(s) 93
ApeKI GCWGC 1 cut(s) 107
Bbv12I GWGCWC 1 cut(s) 93
BbvI GCAGC 1 cut(s) 94
BfaI CTAG 1 cut(s) 42
BisI GCNGC 1 cut(s) 108
BlsI GCNGC 1 cut(s) 109
BmsI GCATC 2 cut(s) 2, 61
BseGI GGATG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 93
Bsp1286I GDGCHC 1 cut(s) 93
BstF5I GGATG 1 cut(s) 17
BstV1I GCAGC 1 cut(s) 94
BtsCI GGATG 1 cut(s) 17
CviAII CATG 1 cut(s) 18
CviJI RGCY 3 cut(s) 45, 74, 107
CviKI_1 RGCY 3 cut(s) 45, 74, 107
FaeI CATG 1 cut(s) 21
FaiI YATR 1 cut(s) 19
FatI CATG 1 cut(s) 17
Fnu4HI GCNGC 1 cut(s) 108
FokI GGATG 1 cut(s) 24
Fsp4HI GCNGC 1 cut(s) 108
FspBI CTAG 1 cut(s) 42
GluI GCNGC 1 cut(s) 108
Hin1II CATG 1 cut(s) 21
HinfI GANTC 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 67, 110
Hsp92II CATG 1 cut(s) 21
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 1 cut(s) 41
Lsp1109I GCAGC 1 cut(s) 94
LweI GCATC 2 cut(s) 2, 61
MaeI CTAG 1 cut(s) 42
MfeI CAATTG 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 2 cut(s) 26, 68
MmeI TCCRAC 1 cut(s) 66
MnlI CCTC 2 cut(s) 111, 114
MunI CAATTG 1 cut(s) 68
NlaIII CATG 1 cut(s) 21
PfeI GAWTC 1 cut(s) 98
PkrI GCNGC 1 cut(s) 109
SatI GCNGC 1 cut(s) 108
SduI GDGCHC 1 cut(s) 93
SetI ASST 2 cut(s) 60, 109
SfaNI GCATC 2 cut(s) 2, 61
SgeI CNNG 5 cut(s) 30, 54, 68, 76, 106
Sse9I AATT 2 cut(s) 26, 68
SspMI CTAG 1 cut(s) 42
TasI AATT 2 cut(s) 26, 68
TfiI GAWTC 1 cut(s) 98
TseI GCWGC 1 cut(s) 107
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.