Rh1CG188000

ATP-dependent DNA helicase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
41011243 .. 41011628
386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG188000.1

Sequence Viewer

Length: 312 bp
ATGTCAGAGGCTGATCTAAGAATCATTTGGACAATATTGAGCATGGTAATTCTGACATATATGTTGAAGCAAATTCATTTCAGGAAAATGGTTCAAGTGCTTCAAAGGGAAGGGAGTCAATTGACTACTTGGAAAATGATGTTGACACCTTTCACATTGAATGATTGGGATGTTAGCTGTGGTGAATTCTATGGACTACCTCTATTTGAGGACTTGAATACTAGAAAAGAAACTACATCTGGATCTACCAAGTCAACCAGAAGAAAGACTGAGACTTCTACAACAGCCCCTAGAGAAAGATCTAAATCCTAA

Protein Analysis

103

Amino Acids

12.03

Weight (kDa)

9.51

Isoelectric Point (pI)

56.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 250
AcsI RAATTY 2 cut(s) 72, 185
AgsI TTSAA 5 cut(s) 67, 95, 104, 160, 217
AluBI AGCT 1 cut(s) 177
AluI AGCT 1 cut(s) 177
Alw26I GTCTC 1 cut(s) 266
AlwI GGATC 1 cut(s) 250
AlwNI CAGNNNCTG 1 cut(s) 11
ApoI RAATTY 2 cut(s) 72, 185
AsuHPI GGTGA 1 cut(s) 194
BcoDI GTCTC 1 cut(s) 266
BfaI CTAG 2 cut(s) 222, 291
BglII AGATCT 1 cut(s) 299
BsaBI GATNNNNATC 1 cut(s) 304
Bse8I GATNNNNATC 1 cut(s) 304
BseGI GGATG 1 cut(s) 175
BseJI GATNNNNATC 1 cut(s) 304
BseMII CTCAG 1 cut(s) 261
BsmAI GTCTC 1 cut(s) 266
Bsp143I GATC 3 cut(s) 13, 242, 299
BspCNI CTCAG 1 cut(s) 262
BspPI GGATC 1 cut(s) 250
BssMI GATC 3 cut(s) 13, 242, 299
BstDEI CTNAG 2 cut(s) 17, 270
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 3 cut(s) 16, 245, 302
BstMAI GTCTC 1 cut(s) 266
BstMBI GATC 3 cut(s) 13, 242, 299
BstX2I RGATCY 2 cut(s) 242, 299
BstYI RGATCY 2 cut(s) 242, 299
BtsCI GGATG 1 cut(s) 175
CaiI CAGNNNCTG 1 cut(s) 11
CviAII CATG 1 cut(s) 43
CviJI RGCY 3 cut(s) 11, 177, 287
CviKI_1 RGCY 3 cut(s) 11, 177, 287
DdeI CTNAG 2 cut(s) 17, 270
DpnI GATC 3 cut(s) 15, 244, 301
DpnII GATC 3 cut(s) 13, 242, 299
EcoRI GAATTC 1 cut(s) 185
FaeI CATG 1 cut(s) 46
FaiI YATR 5 cut(s) 44, 58, 60, 62, 192
FatI CATG 1 cut(s) 42
FokI GGATG 1 cut(s) 182
FspBI CTAG 2 cut(s) 222, 291
Hin1II CATG 1 cut(s) 46
HincII GTYRAC 2 cut(s) 144, 255
HindII GTYRAC 2 cut(s) 144, 255
HinfI GANTC 2 cut(s) 21, 115
HphI GGTGA 1 cut(s) 194
Hpy166II GTNNAC 2 cut(s) 144, 255
Hpy188I TCNGA 2 cut(s) 7, 54
Hpy188III TCNNGA 2 cut(s) 82, 240
Hpy8I GTNNAC 2 cut(s) 144, 255
HpyAV CCTTC 1 cut(s) 104
HpyF3I CTNAG 2 cut(s) 17, 270
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 3 cut(s) 13, 242, 299
LpnPI CCDG 3 cut(s) 67, 225, 271
MaeI CTAG 2 cut(s) 222, 291
MalI GATC 3 cut(s) 15, 244, 301
MboI GATC 3 cut(s) 13, 242, 299
MboII GAAGA 1 cut(s) 273
MfeI CAATTG 1 cut(s) 119
MflI RGATCY 2 cut(s) 242, 299
MluCI AATT 4 cut(s) 48, 72, 119, 185
MlyI GAGTC 1 cut(s) 124
MnlI CCTC 2 cut(s) 202, 210
MunI CAATTG 1 cut(s) 119
NdeII GATC 3 cut(s) 13, 242, 299
NlaIII CATG 1 cut(s) 46
PfeI GAWTC 1 cut(s) 21
PleI GAGTC 1 cut(s) 123
PpsI GAGTC 1 cut(s) 123
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 2 cut(s) 242, 299
Sau3AI GATC 3 cut(s) 13, 242, 299
SchI GAGTC 1 cut(s) 124
SetI ASST 3 cut(s) 151, 179, 202
Sse9I AATT 4 cut(s) 48, 72, 119, 185
SspI AATATT 1 cut(s) 36
SspMI CTAG 2 cut(s) 222, 291
TasI AATT 4 cut(s) 48, 72, 119, 185
TfiI GAWTC 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 65
XapI RAATTY 2 cut(s) 72, 185
XspI CTAG 2 cut(s) 222, 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.