RchiOBHm_Chr6g0273161

Peptide chain release factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
33795205 .. 33795810
606 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24506

Sequence Viewer

Length: 240 bp
ATGGAATTCAAAATGATAATTGAAGATGATGTTCTCCGAGCTGAGATGTTGGCCCCATTGGCACTGGAGCTTGAAGAAGAAAGACGGAATGAGCAAGAACAACTGATACGCAACTATGACCTCTGGGATGACACTGCTGAGTCCAATGAGGTTCTTGCCAAATTAGCTGATAGTGTTAGAGTGGTTGATGCTCTCAGAGACTTGACATATAAGGCTGAAGAAGCAAAACTTATTACATAG

Protein Analysis

79

Amino Acids

9.24

Weight (kDa)

4.27

Isoelectric Point (pI)

61.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 237
AgsI TTSAA 3 cut(s) 10, 23, 74
AluBI AGCT 3 cut(s) 41, 70, 167
AluI AGCT 3 cut(s) 41, 70, 167
Alw26I GTCTC 1 cut(s) 192
AoxI GGCC 1 cut(s) 51
ApoI RAATTY 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 52
BcoDI GTCTC 1 cut(s) 192
BglI GCCNNNNNGGC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 54
BmsI GCATC 1 cut(s) 178
BpmI CTGGAG 1 cut(s) 86
Bse1I ACTGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 133
BseMII CTCAG 3 cut(s) 33, 129, 208
BseNI ACTGG 1 cut(s) 69
BshFI GGCC 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 192
BsnI GGCC 1 cut(s) 53
BspANI GGCC 1 cut(s) 53
BspCNI CTCAG 3 cut(s) 34, 130, 207
BspLI GGNNCC 1 cut(s) 54
BsrI ACTGG 1 cut(s) 69
BstDEI CTNAG 3 cut(s) 42, 138, 194
BstF5I GGATG 1 cut(s) 133
BstMAI GTCTC 1 cut(s) 192
BstMWI GCNNNNNNNGC 3 cut(s) 59, 164, 221
BsuRI GGCC 1 cut(s) 53
BtsCI GGATG 1 cut(s) 133
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 2 cut(s) 62, 132
Cfr13I GGNCC 1 cut(s) 52
CviJI RGCY 5 cut(s) 41, 53, 70, 167, 215
CviKI_1 RGCY 5 cut(s) 41, 53, 70, 167, 215
DdeI CTNAG 3 cut(s) 42, 138, 194
Eco57I CTGAAG 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 5
FaiI YATR 4 cut(s) 117, 208, 210, 238
FalI AAGNNNNNCTT 1 cut(s) 213
FokI GGATG 1 cut(s) 140
GsuI CTGGAG 1 cut(s) 86
HaeIII GGCC 1 cut(s) 53
HinfI GANTC 1 cut(s) 140
Hpy188I TCNGA 2 cut(s) 38, 197
HpyF10VI GCNNNNNNNGC 3 cut(s) 59, 164, 221
HpyF3I CTNAG 3 cut(s) 42, 138, 194
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 2 cut(s) 50, 109
LweI GCATC 1 cut(s) 178
MboII GAAGA 4 cut(s) 35, 86, 89, 230
MluCI AATT 3 cut(s) 5, 18, 161
MlyI GAGTC 1 cut(s) 149
MnlI CCTC 2 cut(s) 131, 142
MwoI GCNNNNNNNGC 3 cut(s) 59, 164, 221
NlaIV GGNNCC 1 cut(s) 54
PleI GAGTC 1 cut(s) 148
PpsI GAGTC 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 52
PsrI GAACNNNNNNTAC 2 cut(s) 90, 122
Sau96I GGNCC 1 cut(s) 52
SchI GAGTC 1 cut(s) 149
SetI ASST 5 cut(s) 43, 72, 123, 153, 169
SfaNI GCATC 1 cut(s) 178
SgeI CNNG 7 cut(s) 50, 77, 83, 107, 136, 167, 214
Sse9I AATT 3 cut(s) 5, 18, 161
TasI AATT 3 cut(s) 5, 18, 161
TscAI CASTG 2 cut(s) 69, 139
TspGWI ACGGA 1 cut(s) 100
TspRI CASTG 2 cut(s) 69, 139
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.