RchiOBHm_Chr7g0206221

tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
23891181 .. 23893491
2311 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18455

Sequence Viewer

Length: 201 bp
ATGGAATCATGCTCATCATCATGGGATTCTTGTGTGTCATTTATGCTCACACACAATTGGTGGCATGTAGCTCTTTGTTATATGGAAGGTCATTCTCCAGTCGAAAGACTCTTAGAGATATATGACCATCATATCTGGAAGGAGTTGGAAAAAGTTGATGCTTTTGGACCAGTGATGGATTGGAGTTTCTACTCTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.9

Weight (kDa)

4.74

Isoelectric Point (pI)

69.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
BccI CCATC 2 cut(s) 135, 169
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmsI GCATC 1 cut(s) 148
BpmI CTGGAG 1 cut(s) 81
Bse1I ACTGG 2 cut(s) 98, 170
BseNI ACTGG 2 cut(s) 98, 170
BsrI ACTGG 2 cut(s) 98, 170
BstDEI CTNAG 1 cut(s) 112
BstNSI RCATGY 1 cut(s) 68
BtsIMutI CAGTG 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 3 cut(s) 9, 21, 65
CviJI RGCY 1 cut(s) 71
CviKI_1 RGCY 1 cut(s) 71
DdeI CTNAG 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 167
FaeI CATG 3 cut(s) 12, 24, 68
FaiI YATR 9 cut(s) 10, 22, 44, 66, 81, 83, 121, 123, 132
FatI CATG 3 cut(s) 8, 20, 64
GsuI CTGGAG 1 cut(s) 81
Hin1II CATG 3 cut(s) 12, 24, 68
HinfI GANTC 3 cut(s) 5, 26, 108
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 136
HpyAV CCTTC 2 cut(s) 80, 133
HpyF3I CTNAG 1 cut(s) 112
Hsp92II CATG 3 cut(s) 12, 24, 68
LpnPI CCDG 3 cut(s) 111, 121, 183
LweI GCATC 1 cut(s) 148
MfeI CAATTG 1 cut(s) 55
MluCI AATT 1 cut(s) 55
MlyI GAGTC 1 cut(s) 102
MmeI TCCRAC 1 cut(s) 126
MseI TTAA 1 cut(s) 199
MslI CAYNNNNRTG 1 cut(s) 19
MunI CAATTG 1 cut(s) 55
NlaIII CATG 3 cut(s) 12, 24, 68
NspI RCATGY 1 cut(s) 68
PfeI GAWTC 2 cut(s) 5, 26
PleI GAGTC 1 cut(s) 102
PpsI GAGTC 1 cut(s) 102
PspPI GGNCC 1 cut(s) 167
RseI CAYNNNNRTG 1 cut(s) 19
SaqAI TTAA 1 cut(s) 199
Sau96I GGNCC 1 cut(s) 167
SchI GAGTC 1 cut(s) 102
SetI ASST 2 cut(s) 73, 91
SfaNI GCATC 1 cut(s) 148
SgeI CNNG 7 cut(s) 21, 33, 42, 77, 110, 148, 182
SinI GGWCC 1 cut(s) 167
SmiMI CAYNNNNRTG 1 cut(s) 19
Sse9I AATT 1 cut(s) 55
TaqI TCGA 1 cut(s) 102
TasI AATT 1 cut(s) 55
TfiI GAWTC 2 cut(s) 5, 26
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
TscAI CASTG 1 cut(s) 177
TspRI CASTG 1 cut(s) 177
VpaK11BI GGWCC 1 cut(s) 167
XceI RCATGY 1 cut(s) 68
XcmI CCANNNNNNNNNTGG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.