RLG00000028785

tetratricopeptide repeat protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
27986520 .. 27990946
4427 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000028785

Sequence Viewer

Length: 495 bp
ATGTTCCTGTACAACTTCATGAGAGGTTTCAAGTGTGAGTGTGCTGCTGCTGCTGCTGCATGTGAGAGTATTACTAGGTCCTTAGTTATAGAGGAACCTGGAGACCATGGAGAAGCACACTTAGTAGCTCTGGTGGAGATATGTAGGATGCTATTGATAGCGTATCAAAGGCTTCTCAAAAGATGGAGTGAGTCACAGTTCTACCAAGTCTTGAATGTATTATTGGATCAGATTATTGAGCTTTTAACAAAATCTTCCAAGCTGATGCTAAAGAGTGTTACAACTATCAGGCTCACACACAATTGGTGGCATGTAGCTCTTTGTTATATGGAAGGTCATTCTCCAGTCGAAAGACTCTTAGAGATATATGACCATCATATCTGGAAGGAGTTGGAAAAAGTTGATGCTTTTGGACCAGAGATGGATTGGGCTTTCTACTCGTTTCTGATTAAGAAAGTGCTTCATTTGCATCTCTATGCAATAATATTAGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

165

Amino Acids

19.21

Weight (kDa)

6.29

Isoelectric Point (pI)

49.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 234
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 2 cut(s) 31, 214
AjnI CCWGG 1 cut(s) 97
AjuI GAANNNNNNNTTGG 2 cut(s) 206, 238
AluBI AGCT 4 cut(s) 128, 241, 262, 317
AluI AGCT 4 cut(s) 128, 241, 262, 317
Alw26I GTCTC 1 cut(s) 96
AlwI GGATC 1 cut(s) 234
ApeKI GCWGC 5 cut(s) 44, 47, 50, 53, 56
AspS9I GGNCC 2 cut(s) 78, 413
AvaII GGWCC 2 cut(s) 78, 413
BbvI GCAGC 5 cut(s) 31, 34, 37, 40, 43
BccI CCATC 3 cut(s) 177, 381, 415
BciT130I CCWGG 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 96
BfaI CTAG 1 cut(s) 75
BisI GCNGC 5 cut(s) 45, 48, 51, 54, 57
BlsI GCNGC 5 cut(s) 46, 49, 52, 55, 58
Bme1390I CCNGG 1 cut(s) 99
Bme18I GGWCC 2 cut(s) 78, 413
BmgT120I GGNCC 2 cut(s) 78, 413
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 99
BmsI GCATC 4 cut(s) 138, 255, 394, 478
BpmI CTGGAG 2 cut(s) 120, 327
BsaI GGTCTC 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 106
Bse1I ACTGG 1 cut(s) 344
BseBI CCWGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 106
BseGI GGATG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 344
BseXI GCAGC 5 cut(s) 31, 34, 37, 40, 43
BsmAI GTCTC 1 cut(s) 96
Bso31I GGTCTC 1 cut(s) 96
Bsp1407I TGTACA 1 cut(s) 9
Bsp143I GATC 1 cut(s) 226
Bsp19I CCATGG 1 cut(s) 106
BspHI TCATGA 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 96
BspPI GGATC 1 cut(s) 234
BspTNI GGTCTC 1 cut(s) 96
BsrGI TGTACA 1 cut(s) 9
BsrI ACTGG 1 cut(s) 344
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 1 cut(s) 226
BssT1I CCWWGG 1 cut(s) 106
Bst2UI CCWGG 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 198
BstAUI TGTACA 1 cut(s) 9
BstDEI CTNAG 3 cut(s) 82, 121, 358
BstDSI CCRYGG 1 cut(s) 106
BstF5I GGATG 1 cut(s) 153
BstKTI GATC 1 cut(s) 229
BstMAI GTCTC 1 cut(s) 96
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 4 cut(s) 50, 53, 56, 466
BstNI CCWGG 1 cut(s) 99
BstNSI RCATGY 2 cut(s) 63, 314
BstSCI CCNGG 1 cut(s) 97
BstV1I GCAGC 5 cut(s) 31, 34, 37, 40, 43
BtgI CCRYGG 1 cut(s) 106
BtsCI GGATG 1 cut(s) 153
CciI TCATGA 1 cut(s) 18
Cfr13I GGNCC 2 cut(s) 78, 413
Csp6I GTAC 1 cut(s) 10
CviAII CATG 4 cut(s) 19, 60, 107, 311
CviJI RGCY 7 cut(s) 128, 172, 241, 262, 292, 317, 431
CviKI_1 RGCY 7 cut(s) 128, 172, 241, 262, 292, 317, 431
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 3 cut(s) 82, 121, 358
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 106
Eco31I GGTCTC 1 cut(s) 96
Eco47I GGWCC 2 cut(s) 78, 413
EcoO109I RGGNCCY 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 97
EcoT14I CCWWGG 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 106
FaeI CATG 4 cut(s) 22, 63, 110, 314
FatI CATG 4 cut(s) 18, 59, 106, 310
Fnu4HI GCNGC 5 cut(s) 45, 48, 51, 54, 57
FokI GGATG 1 cut(s) 160
Fsp4HI GCNGC 5 cut(s) 45, 48, 51, 54, 57
FspBI CTAG 1 cut(s) 75
GluI GCNGC 5 cut(s) 45, 48, 51, 54, 57
GsuI CTGGAG 2 cut(s) 120, 327
Hin1II CATG 4 cut(s) 22, 63, 110, 314
HinfI GANTC 2 cut(s) 191, 354
Hpy188I TCNGA 2 cut(s) 231, 447
Hpy188III TCNNGA 3 cut(s) 19, 211, 382
HpyAV CCTTC 2 cut(s) 326, 379
HpyCH4III ACNGT 1 cut(s) 198
HpyCH4V TGCA 3 cut(s) 59, 469, 479
HpyF10VI GCNNNNNNNGC 4 cut(s) 50, 53, 56, 466
HpyF3I CTNAG 3 cut(s) 82, 121, 358
Hsp92II CATG 4 cut(s) 22, 63, 110, 314
Kzo9I GATC 1 cut(s) 226
LpnPI CCDG 8 cut(s) 20, 84, 111, 116, 274, 357, 367, 429
Lsp1109I GCAGC 5 cut(s) 31, 34, 37, 40, 43
LweI GCATC 4 cut(s) 138, 255, 394, 478
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 2 cut(s) 192, 277
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 1 cut(s) 246
MfeI CAATTG 1 cut(s) 301
MluCI AATT 1 cut(s) 301
MlyI GAGTC 2 cut(s) 200, 348
MmeI TCCRAC 1 cut(s) 372
MnlI CCTC 2 cut(s) 17, 85
MseI TTAA 2 cut(s) 245, 450
MslI CAYNNNNRTG 1 cut(s) 474
MspR9I CCNGG 1 cut(s) 99
MunI CAATTG 1 cut(s) 301
MvaI CCWGG 1 cut(s) 99
MwoI GCNNNNNNNGC 4 cut(s) 50, 53, 56, 466
NcoI CCATGG 1 cut(s) 106
NdeII GATC 1 cut(s) 226
NlaIII CATG 4 cut(s) 22, 63, 110, 314
NlaIV GGNNCC 1 cut(s) 96
NmuCI GTSAC 1 cut(s) 192
NspI RCATGY 2 cut(s) 63, 314
PagI TCATGA 1 cut(s) 18
PkrI GCNGC 5 cut(s) 46, 49, 52, 55, 58
PleI GAGTC 2 cut(s) 199, 348
PpsI GAGTC 2 cut(s) 199, 348
PpuMI RGGWCCY 1 cut(s) 78
Psp5II RGGWCCY 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 2 cut(s) 78, 413
PspPPI RGGWCCY 1 cut(s) 78
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
RseI CAYNNNNRTG 1 cut(s) 474
SaqAI TTAA 2 cut(s) 245, 450
SatI GCNGC 5 cut(s) 45, 48, 51, 54, 57
Sau3AI GATC 1 cut(s) 226
Sau96I GGNCC 2 cut(s) 78, 413
SchI GAGTC 2 cut(s) 200, 348
ScrFI CCNGG 1 cut(s) 99
SetI ASST 8 cut(s) 28, 80, 100, 130, 243, 264, 319, 337
SfaNI GCATC 4 cut(s) 138, 255, 394, 478
SinI GGWCC 2 cut(s) 78, 413
SmiMI CAYNNNNRTG 1 cut(s) 474
Sse9I AATT 1 cut(s) 301
SspI AATATT 1 cut(s) 486
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 97
StyI CCWWGG 1 cut(s) 106
TaaI ACNGT 1 cut(s) 198
TaqI TCGA 1 cut(s) 348
TasI AATT 1 cut(s) 301
TatI WGTACW 1 cut(s) 9
Tru1I TTAA 2 cut(s) 245, 450
Tru9I TTAA 2 cut(s) 245, 450
TseFI GTSAC 1 cut(s) 192
TseI GCWGC 5 cut(s) 44, 47, 50, 53, 56
Tsp45I GTSAC 1 cut(s) 192
TspDTI ATGAA 2 cut(s) 7, 452
VpaK11BI GGWCC 2 cut(s) 78, 413
XceI RCATGY 2 cut(s) 63, 314
XcmI CCANNNNNNNNNTGG 1 cut(s) 423
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.