RchiOBHm_Chr7g0215091

Belongs to the RNase T2 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0005271
Physical Location & Seq
Reverse (-)
32553383 .. 32554021
639 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19246

Sequence Viewer

Length: 345 bp
ATGCAAGAATGGCAGAAATATGGGACTTGTGCAGAATCACTCTTTGGAGGTCAATACCAATACTTTCATGCAGGTCTCAATCTCAGGAAGAAAATAGACATGCTCCAGATACTCAGCAATGCAGGAATCCATCCAAATGGGTCATTTTATGAGATGACTGCAGTTTTCAATGCCATACAAAAGGCCACCATCCATCTTCCGGGGTTTATCTGTAACAAAGACAAATCAGGCAACAAACAGCTCTGTGGAAACACCGCCGGAACCAGAATCATAGACTGCCTCGGCAACCCAAGATCGAATACCGGACAATGCCCCGAAAACTTTAAGTTCCCTCCCTTGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribonuclease_T2

Protein Analysis

114

Amino Acids

12.69

Weight (kDa)

9.06

Isoelectric Point (pI)

26.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuclease_T2 PF00445 2 - 93 9.8e-19 Ribonuclease T2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 62
AciI CCGC 1 cut(s) 255
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 2 cut(s) 169, 340
AjuI GAANNNNNNNTTGG 2 cut(s) 27, 59
AluBI AGCT 1 cut(s) 241
AluI AGCT 1 cut(s) 241
Alw26I GTCTC 1 cut(s) 80
AoxI GGCC 1 cut(s) 183
AsuC2I CCSGG 1 cut(s) 201
BccI CCATC 3 cut(s) 138, 197, 201
BcnI CCSGG 1 cut(s) 201
BcoDI GTCTC 1 cut(s) 80
BfmI CTRYAG 1 cut(s) 159
BfuAI ACCTGC 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 262
BmrFI CCNGG 1 cut(s) 201
BpmI CTGGAG 1 cut(s) 89
BpuMI CCSGG 1 cut(s) 201
BsaI GGTCTC 1 cut(s) 80
BsaJI CCNNGG 2 cut(s) 200, 280
BsaWI WCCGGW 1 cut(s) 302
Bsc4I CCNNNNNNNGG 1 cut(s) 199
Bse3DI GCAATG 1 cut(s) 124
BseDI CCNNGG 2 cut(s) 200, 280
BseGI GGATG 2 cut(s) 130, 189
BseLI CCNNNNNNNGG 1 cut(s) 199
BseMI GCAATG 1 cut(s) 124
BseMII CTCAG 2 cut(s) 97, 127
BsgI GTGCAG 1 cut(s) 51
BshFI GGCC 1 cut(s) 185
BsiSI CCGG 3 cut(s) 200, 258, 303
BslFI GGGAC 1 cut(s) 37
BslI CCNNNNNNNGG 1 cut(s) 199
BsmAI GTCTC 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 1 cut(s) 185
Bso31I GGTCTC 1 cut(s) 80
Bsp143I GATC 1 cut(s) 293
BspACI CCGC 1 cut(s) 255
BspANI GGCC 1 cut(s) 185
BspCNI CTCAG 2 cut(s) 96, 126
BspLI GGNNCC 1 cut(s) 262
BspMAI CTGCAG 1 cut(s) 163
BspMI ACCTGC 1 cut(s) 62
BspTNI GGTCTC 1 cut(s) 80
BsrDI GCAATG 1 cut(s) 124
BssECI CCNNGG 2 cut(s) 200, 280
BssMI GATC 1 cut(s) 293
BstDEI CTNAG 2 cut(s) 83, 113
BstF5I GGATG 2 cut(s) 130, 189
BstKTI GATC 1 cut(s) 296
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 1 cut(s) 293
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNSI RCATGY 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 199
BstSFI CTRYAG 1 cut(s) 159
BstXI CCANNNNNNTGG 1 cut(s) 137
BsuRI GGCC 1 cut(s) 185
BtsCI GGATG 2 cut(s) 130, 189
BveI ACCTGC 1 cut(s) 62
CviAII CATG 2 cut(s) 68, 100
CviJI RGCY 2 cut(s) 185, 241
CviKI_1 RGCY 2 cut(s) 185, 241
DdeI CTNAG 2 cut(s) 83, 113
DpnI GATC 1 cut(s) 295
DpnII GATC 1 cut(s) 293
Eco31I GGTCTC 1 cut(s) 80
FaeI CATG 2 cut(s) 71, 103
FaiI YATR 6 cut(s) 21, 69, 101, 150, 176, 272
FaqI GGGAC 1 cut(s) 37
FatI CATG 2 cut(s) 67, 99
FokI GGATG 2 cut(s) 117, 176
GsuI CTGGAG 1 cut(s) 89
HaeIII GGCC 1 cut(s) 185
HapII CCGG 3 cut(s) 200, 258, 303
Hin1II CATG 2 cut(s) 71, 103
HinfI GANTC 3 cut(s) 35, 126, 267
HpaII CCGG 3 cut(s) 200, 258, 303
Hpy188III TCNNGA 2 cut(s) 85, 106
HpyCH4V TGCA 5 cut(s) 4, 32, 71, 122, 161
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 83, 113
Hsp92II CATG 2 cut(s) 71, 103
Kzo9I GATC 1 cut(s) 293
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 9 cut(s) 57, 70, 108, 119, 213, 213, 271, 277, 316
MaeIII GTNAC 1 cut(s) 212
MalI GATC 1 cut(s) 295
MboI GATC 1 cut(s) 293
MboII GAAGA 2 cut(s) 100, 188
MnlI CCTC 3 cut(s) 41, 290, 342
MseI TTAA 1 cut(s) 324
MslI CAYNNNNRTG 1 cut(s) 135
MspI CCGG 3 cut(s) 200, 258, 303
MspR9I CCNGG 1 cut(s) 201
MwoI GCNNNNNNNGC 1 cut(s) 10
NciI CCSGG 1 cut(s) 201
NdeII GATC 1 cut(s) 293
NlaIII CATG 2 cut(s) 71, 103
NlaIV GGNNCC 1 cut(s) 262
NmeAIII GCCGAG 1 cut(s) 261
NspI RCATGY 1 cut(s) 103
PfeI GAWTC 3 cut(s) 35, 126, 267
PspN4I GGNNCC 1 cut(s) 262
PstI CTGCAG 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 135
SaqAI TTAA 1 cut(s) 324
Sau3AI GATC 1 cut(s) 293
ScrFI CCNGG 1 cut(s) 201
SetI ASST 3 cut(s) 52, 76, 243
SfcI CTRYAG 1 cut(s) 159
SmiMI CAYNNNNRTG 1 cut(s) 135
SsiI CCGC 1 cut(s) 255
StyD4I CCNGG 1 cut(s) 199
TaqI TCGA 1 cut(s) 296
TfiI GAWTC 3 cut(s) 35, 126, 267
Tru1I TTAA 1 cut(s) 324
Tru9I TTAA 1 cut(s) 324
TspDTI ATGAA 1 cut(s) 56
XceI RCATGY 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.