Rmu_sc0001239.1_g000001

Belongs to the RNase T2 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001239.1
OG0005271
Physical Location & Seq
Reverse (-)
1184 .. 1633
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001239.1_g000001.1.cds

Sequence Viewer

Length: 450 bp
atggcagaaatatgggacttgtgcagaatcactctttggaggttaataccaatactttcatgcaggtctcaatctcaggaagaaaatagacatgctccagatactcagcaatgcaggtctgatcacactactataatccaactttcggatttcagttcaaataaattagtggaactcaaaacttttcgcttaataatatcggtatttgatgcaggaatccatccaaatgggtcattttatgagatgactgcagttttcaatgccatacaaaaggccaccatctatcttccggggtttatctgtaacaaagacaaatcaggcaacaaacagctctaccagattatactctgtggaaacaccgccggaaccagaatcatagactgcctcggcaacccaagatcgaatactggacaatgccccgaaaactttaagttccctcccttgaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribonuclease_T2

Protein Analysis

149

Amino Acids

16.88

Weight (kDa)

8.51

Isoelectric Point (pI)

44.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 54, 105
AciI CCGC 1 cut(s) 360
AfiI CCNNNNNNNGG 1 cut(s) 145
AgsI TTSAA 3 cut(s) 159, 259, 445
AjuI GAANNNNNNNTTGG 2 cut(s) 19, 51
AluBI AGCT 1 cut(s) 331
AluI AGCT 1 cut(s) 331
Alw26I GTCTC 1 cut(s) 72
AoxI GGCC 1 cut(s) 273
AsuC2I CCSGG 1 cut(s) 291
BccI CCATC 2 cut(s) 228, 287
BclI TGATCA 1 cut(s) 121
BcnI CCSGG 1 cut(s) 291
BcoDI GTCTC 1 cut(s) 72
BfmI CTRYAG 1 cut(s) 249
BfuAI ACCTGC 2 cut(s) 54, 105
Bme1390I CCNGG 1 cut(s) 291
BmiI GGNNCC 1 cut(s) 367
BmrFI CCNGG 1 cut(s) 291
BmsI GCATC 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 81
BpuMI CCSGG 1 cut(s) 291
BsaI GGTCTC 1 cut(s) 72
BsaJI CCNNGG 2 cut(s) 290, 385
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse1I ACTGG 1 cut(s) 412
Bse3DI GCAATG 1 cut(s) 116
BseDI CCNNGG 2 cut(s) 290, 385
BseGI GGATG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 145
BseMI GCAATG 1 cut(s) 116
BseMII CTCAG 2 cut(s) 89, 119
BseNI ACTGG 1 cut(s) 412
BsgI GTGCAG 1 cut(s) 43
BshFI GGCC 1 cut(s) 275
BsiSI CCGG 2 cut(s) 290, 363
BslFI GGGAC 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 145
BsmAI GTCTC 1 cut(s) 72
BsmFI GGGAC 1 cut(s) 29
BsnI GGCC 1 cut(s) 275
Bso31I GGTCTC 1 cut(s) 72
Bsp143I GATC 2 cut(s) 121, 398
BspACI CCGC 1 cut(s) 360
BspANI GGCC 1 cut(s) 275
BspCNI CTCAG 2 cut(s) 88, 118
BspLI GGNNCC 1 cut(s) 367
BspMAI CTGCAG 1 cut(s) 253
BspMI ACCTGC 2 cut(s) 54, 105
BspTNI GGTCTC 1 cut(s) 72
BsrDI GCAATG 1 cut(s) 116
BsrI ACTGG 1 cut(s) 412
BssECI CCNNGG 2 cut(s) 290, 385
BssMI GATC 2 cut(s) 121, 398
BstDEI CTNAG 2 cut(s) 75, 105
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 2 cut(s) 124, 401
BstMAI GTCTC 1 cut(s) 72
BstMBI GATC 2 cut(s) 121, 398
BstNSI RCATGY 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 289
BstSFI CTRYAG 1 cut(s) 249
BstXI CCANNNNNNTGG 1 cut(s) 227
BsuRI GGCC 1 cut(s) 275
BtsCI GGATG 1 cut(s) 220
BveI ACCTGC 2 cut(s) 54, 105
CviAII CATG 2 cut(s) 60, 92
CviJI RGCY 2 cut(s) 275, 331
CviKI_1 RGCY 2 cut(s) 275, 331
DdeI CTNAG 2 cut(s) 75, 105
DpnI GATC 2 cut(s) 123, 400
DpnII GATC 2 cut(s) 121, 398
Eco31I GGTCTC 1 cut(s) 72
FaeI CATG 2 cut(s) 63, 95
FaiI YATR 8 cut(s) 13, 61, 93, 134, 240, 266, 344, 377
FaqI GGGAC 1 cut(s) 29
FatI CATG 2 cut(s) 59, 91
FbaI TGATCA 1 cut(s) 121
FokI GGATG 1 cut(s) 207
GsuI CTGGAG 1 cut(s) 81
HaeIII GGCC 1 cut(s) 275
HapII CCGG 2 cut(s) 290, 363
Hin1II CATG 2 cut(s) 63, 95
HinfI GANTC 3 cut(s) 27, 216, 372
HpaII CCGG 2 cut(s) 290, 363
Hpy188I TCNGA 2 cut(s) 121, 148
Hpy188III TCNNGA 2 cut(s) 77, 98
HpyCH4V TGCA 5 cut(s) 24, 63, 114, 212, 251
HpyF3I CTNAG 2 cut(s) 75, 105
Hsp92II CATG 2 cut(s) 63, 95
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 2 cut(s) 121, 398
LmnI GCTCC 1 cut(s) 100
LweI GCATC 1 cut(s) 199
MaeIII GTNAC 1 cut(s) 302
MalI GATC 2 cut(s) 123, 400
MboI GATC 2 cut(s) 121, 398
MboII GAAGA 2 cut(s) 92, 278
MluCI AATT 1 cut(s) 164
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 3 cut(s) 33, 395, 447
MseI TTAA 3 cut(s) 44, 191, 429
MslI CAYNNNNRTG 1 cut(s) 225
MspI CCGG 2 cut(s) 290, 363
MspR9I CCNGG 1 cut(s) 291
NciI CCSGG 1 cut(s) 291
NdeII GATC 2 cut(s) 121, 398
NlaIII CATG 2 cut(s) 63, 95
NlaIV GGNNCC 1 cut(s) 367
NmeAIII GCCGAG 1 cut(s) 366
NspI RCATGY 1 cut(s) 95
PfeI GAWTC 3 cut(s) 27, 216, 372
PspN4I GGNNCC 1 cut(s) 367
PstI CTGCAG 1 cut(s) 253
RseI CAYNNNNRTG 1 cut(s) 225
SaqAI TTAA 3 cut(s) 44, 191, 429
Sau3AI GATC 2 cut(s) 121, 398
ScrFI CCNGG 1 cut(s) 291
SetI ASST 4 cut(s) 44, 68, 119, 333
SfaNI GCATC 1 cut(s) 199
SfcI CTRYAG 1 cut(s) 249
SmiMI CAYNNNNRTG 1 cut(s) 225
Sse9I AATT 1 cut(s) 164
SsiI CCGC 1 cut(s) 360
StyD4I CCNGG 1 cut(s) 289
TaqI TCGA 1 cut(s) 401
TasI AATT 1 cut(s) 164
TfiI GAWTC 3 cut(s) 27, 216, 372
Tru1I TTAA 3 cut(s) 44, 191, 429
Tru9I TTAA 3 cut(s) 44, 191, 429
TspDTI ATGAA 1 cut(s) 48
XceI RCATGY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.