RchiOBHm_Chr7g0233551

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
58036890 .. 58037295
406 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20935

Sequence Viewer

Length: 237 bp
ATGAGGCTTAGTCCCGCGAAAGCGGTGGTGGTGGTCCTCGTAAAGGGGAAGGCAGTAGCTACAGAAGTGGCGGTGGAGGTTATGGCGGCGGTGGCTGTCGTGAGGGTGGAGACAATGGCTACAGCCATGGAGGTGGTAGCTATGGAAGCGAGAGTGGAGGTAGCTATGAAGGTGGTGGTCGAGACCGTAGATCTGATGACAGCAGTTGGAGGAGTTAGATCTATTAGGGTTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.14

Weight (kDa)

8.19

Isoelectric Point (pI)

22.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 17
AciI CCGC 5 cut(s) 15, 23, 71, 86, 89
AfiI CCNNNNNNNGG 1 cut(s) 43
AluBI AGCT 3 cut(s) 59, 140, 164
AluI AGCT 3 cut(s) 59, 140, 164
Alw26I GTCTC 2 cut(s) 104, 176
AspS9I GGNCC 1 cut(s) 34
AvaII GGWCC 1 cut(s) 34
BcoDI GTCTC 2 cut(s) 104, 176
BfmI CTRYAG 2 cut(s) 60, 120
BglII AGATCT 2 cut(s) 190, 218
BisI GCNGC 1 cut(s) 87
BlsI GCNGC 1 cut(s) 88
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BsaI GGTCTC 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 126
Bsc4I CCNNNNNNNGG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 43
BseRI GAGGAG 1 cut(s) 225
Bsh1236I CGCG 1 cut(s) 17
BslI CCNNNNNNNGG 1 cut(s) 43
BsmAI GTCTC 2 cut(s) 104, 176
Bso31I GGTCTC 1 cut(s) 176
Bsp143I GATC 2 cut(s) 190, 218
Bsp19I CCATGG 1 cut(s) 126
BspACI CCGC 5 cut(s) 15, 23, 71, 86, 89
BspFNI CGCG 1 cut(s) 17
BspTNI GGTCTC 1 cut(s) 176
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 2 cut(s) 190, 218
BssT1I CCWWGG 1 cut(s) 126
Bst4CI ACNGT 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 8
BstDSI CCRYGG 1 cut(s) 126
BstENI CCTNNNNNAGG 1 cut(s) 41
BstFNI CGCG 1 cut(s) 17
BstKTI GATC 2 cut(s) 193, 221
BstMAI GTCTC 2 cut(s) 104, 176
BstMBI GATC 2 cut(s) 190, 218
BstMWI GCNNNNNNNGC 2 cut(s) 92, 146
BstSFI CTRYAG 2 cut(s) 60, 120
BstUI CGCG 1 cut(s) 17
BstX2I RGATCY 2 cut(s) 190, 218
BstXI CCANNNNNNTGG 1 cut(s) 133
BstYI RGATCY 2 cut(s) 190, 218
BtgI CCRYGG 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 34
CviAII CATG 1 cut(s) 127
CviJI RGCY 7 cut(s) 7, 59, 95, 119, 125, 140, 164
CviKI_1 RGCY 7 cut(s) 7, 59, 95, 119, 125, 140, 164
DdeI CTNAG 1 cut(s) 8
DpnI GATC 2 cut(s) 192, 220
DpnII GATC 2 cut(s) 190, 218
Eco130I CCWWGG 1 cut(s) 126
Eco31I GGTCTC 1 cut(s) 176
Eco47I GGWCC 1 cut(s) 34
EcoNI CCTNNNNNAGG 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 1 cut(s) 130
FaiI YATR 4 cut(s) 83, 128, 143, 167
FatI CATG 1 cut(s) 126
FauI CCCGC 1 cut(s) 22
Fnu4HI GCNGC 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 87
GluI GCNGC 1 cut(s) 87
Hin1II CATG 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 2 cut(s) 100, 181
HpyAV CCTTC 2 cut(s) 43, 163
HpyCH4III ACNGT 1 cut(s) 187
HpyF10VI GCNNNNNNNGC 2 cut(s) 92, 146
HpyF3I CTNAG 1 cut(s) 8
Hsp92II CATG 1 cut(s) 130
Kzo9I GATC 2 cut(s) 190, 218
MalI GATC 2 cut(s) 192, 220
MboI GATC 2 cut(s) 190, 218
MflI RGATCY 2 cut(s) 190, 218
MmeI TCCRAC 1 cut(s) 187
MnlI CCTC 6 cut(s) 47, 70, 96, 124, 151, 203
MslI CAYNNNNRTG 1 cut(s) 131
MvnI CGCG 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 92, 146
NcoI CCATGG 1 cut(s) 126
NdeII GATC 2 cut(s) 190, 218
NlaIII CATG 1 cut(s) 130
PkrI GCNGC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 34
PsuI RGATCY 2 cut(s) 190, 218
RseI CAYNNNNRTG 1 cut(s) 131
SatI GCNGC 1 cut(s) 87
Sau3AI GATC 2 cut(s) 190, 218
Sau96I GGNCC 1 cut(s) 34
SetI ASST 7 cut(s) 61, 81, 135, 142, 162, 166, 174
SfcI CTRYAG 2 cut(s) 60, 120
SgeI CNNG 7 cut(s) 26, 28, 50, 112, 139, 162, 193
SinI GGWCC 1 cut(s) 34
SmiMI CAYNNNNRTG 1 cut(s) 131
SsiI CCGC 5 cut(s) 15, 23, 71, 86, 89
StyI CCWWGG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 187
TaqI TCGA 1 cut(s) 180
TauI GCSGC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 182
VpaK11BI GGWCC 1 cut(s) 34
XagI CCTNNNNNAGG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.