Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004946.1

Orthogroup ID

OG0004608

Physical Location & Seq

Genomic Coordinates Forward (+)

85777 .. 86270

Gene Structure 494 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004946.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 209 bp

atggcctctgccgagatcgagttccgttgcttcgtcggagggctcgcctgggccaccgacaacgaggccctcgaaagggcctttgctccttttggcgagatcatcgaatcgaagatcatcaacgaccgcgagaccggaaggtcaaggggattcggattcgtcaccttcagcaacgagaaggccatgagggacgcgatcgaaggcatgaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

RRM_1

Protein Analysis

69

Amino Acids

7.67

Weight (kDa)

4.67

Isoelectric Point (pI)

45.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004608)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21660 AT2G21660
fragaria_vesca	FvH4_2g08880 FvH4_2g08880 FvH4_2g08880 FvH4_2g08880
malus_domestica	MD10G1075500.v1.1
prunus_persica	Prupe.1G176300_v2.0.a1 Prupe.2G011900_v2.0.a1 Prupe.3G163600_v2.0.a1 Prupe.5G141500_v2.0.a1 Prupe.7G178900_v2.0.a1 Prupe.8G096400_v2.0.a1 Prupe.8G096400_v2.0.a1 Prupe.8G096400_v2.0.a1 Prupe.8G096400_v2.0.a1 Prupe.8G096400_v2.0.a1 Prupe.8G096400_v2.0.a1 Prupe.8G096400_v2.0.a1
pyrus_communis	pycom05g05700 pycom10g05900
rosa_chinensis	RchiOBHm_Chr6g0264491 RchiOBHm_Chr7g0233551
rosa_multiflora	Rmu_sc0004946.1_g000027
rosa_roxburghii	Rroxscaffold_176G00431830
rosa_rugosa	Rorug06G0013300
rosa_samantha	Rh6AG132700 Rh6BG130100 Rh6CG128400 Rh6DG115500
rosa_wichuraiana	Rw0G020850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	139
AccII	CGCG	2 cut(s)	129, 194
AciI	CCGC	1 cut(s)	127
AcuI	CTGAAG	1 cut(s)	151
AfiI	CCNNNNNNNGG	2 cut(s)	75, 76
AjnI	CCWGG	1 cut(s)	47
Alw26I	GTCTC	1 cut(s)	125
AoxI	GGCC	5 cut(s)	3, 51, 66, 78, 180
AspS9I	GGNCC	3 cut(s)	51, 67, 78
AsuHPI	GGTGA	1 cut(s)	154
BanII	GRGCYC	1 cut(s)	45
BciT130I	CCWGG	1 cut(s)	49
BcoDI	GTCTC	1 cut(s)	125
Bme1390I	CCNGG	1 cut(s)	49
BmgT120I	GGNCC	3 cut(s)	51, 67, 78
BmrFI	CCNGG	1 cut(s)	49
BsaI	GGTCTC	1 cut(s)	125
BsaJI	CCNNGG	1 cut(s)	48
BsaWI	WCCGGW	1 cut(s)	134
Bsc4I	CCNNNNNNNGG	2 cut(s)	75, 76
BseBI	CCWGG	1 cut(s)	49
BseDI	CCNNGG	1 cut(s)	48
BseLI	CCNNNNNNNGG	2 cut(s)	75, 76
Bsh1236I	CGCG	2 cut(s)	129, 194
Bsh1285I	CGRYCG	2 cut(s)	127, 198
BshFI	GGCC	5 cut(s)	5, 53, 68, 80, 182
BsiEI	CGRYCG	2 cut(s)	127, 198
BsiSI	CCGG	1 cut(s)	135
BslFI	GGGAC	1 cut(s)	203
BslI	CCNNNNNNNGG	2 cut(s)	75, 76
BsmAI	GTCTC	1 cut(s)	125
BsmFI	GGGAC	1 cut(s)	203
BsnI	GGCC	5 cut(s)	5, 53, 68, 80, 182
Bso31I	GGTCTC	1 cut(s)	125
Bsp1286I	GDGCHC	1 cut(s)	45
Bsp143I	GATC	4 cut(s)	15, 99, 114, 195
BspACI	CCGC	1 cut(s)	127
BspANI	GGCC	5 cut(s)	5, 53, 68, 80, 182
BspFNI	CGCG	2 cut(s)	129, 194
BspTNI	GGTCTC	1 cut(s)	125
BssECI	CCNNGG	1 cut(s)	48
BssMI	GATC	4 cut(s)	15, 99, 114, 195
Bst2UI	CCWGG	1 cut(s)	49
BstC8I	GCNNGC	1 cut(s)	45
BstFNI	CGCG	2 cut(s)	129, 194
BstKTI	GATC	4 cut(s)	18, 102, 117, 198
BstMAI	GTCTC	1 cut(s)	125
BstMBI	GATC	4 cut(s)	15, 99, 114, 195
BstMCI	CGRYCG	2 cut(s)	127, 198
BstNI	CCWGG	1 cut(s)	49
BstSCI	CCNGG	1 cut(s)	47
BstUI	CGCG	2 cut(s)	129, 194
BsuRI	GGCC	5 cut(s)	5, 53, 68, 80, 182
Cac8I	GCNNGC	1 cut(s)	45
Cfr13I	GGNCC	3 cut(s)	51, 67, 78
CseI	GACGC	1 cut(s)	200
CviAII	CATG	2 cut(s)	184, 205
CviJI	RGCY	6 cut(s)	5, 43, 53, 68, 80, 182
CviKI_1	RGCY	6 cut(s)	5, 43, 53, 68, 80, 182
DpnI	GATC	4 cut(s)	17, 101, 116, 197
DpnII	GATC	4 cut(s)	15, 99, 114, 195
DrdI	GACNNNNNNGTC	1 cut(s)	139
DseDI	GACNNNNNNGTC	1 cut(s)	139
Eco24I	GRGCYC	1 cut(s)	45
Eco31I	GGTCTC	1 cut(s)	125
Eco57I	CTGAAG	1 cut(s)	151
EcoO109I	RGGNCCY	2 cut(s)	67, 78
EcoRII	CCWGG	1 cut(s)	47
EcoT38I	GRGCYC	1 cut(s)	45
FaeI	CATG	2 cut(s)	187, 208
FaiI	YATR	2 cut(s)	185, 206
FaqI	GGGAC	1 cut(s)	203
FatI	CATG	2 cut(s)	183, 204
FriOI	GRGCYC	1 cut(s)	45
HaeIII	GGCC	5 cut(s)	5, 53, 68, 80, 182
HapII	CCGG	1 cut(s)	135
HgaI	GACGC	1 cut(s)	200
Hin1II	CATG	2 cut(s)	187, 208
HinfI	GANTC	3 cut(s)	107, 150, 156
HpaII	CCGG	1 cut(s)	135
HphI	GGTGA	1 cut(s)	154
Hpy188I	TCNGA	2 cut(s)	38, 155
Hpy99I	CGWCG	1 cut(s)	38
HpyAV	CCTTC	4 cut(s)	132, 172, 175, 194
Hsp92II	CATG	2 cut(s)	187, 208
Kzo9I	GATC	4 cut(s)	15, 99, 114, 195
LmnI	GCTCC	1 cut(s)	91
LpnPI	CCDG	3 cut(s)	34, 61, 148
MaeIII	GTNAC	1 cut(s)	160
MalI	GATC	4 cut(s)	17, 101, 116, 197
MboI	GATC	4 cut(s)	15, 99, 114, 195
MboII	GAAGA	1 cut(s)	124
MhlI	GDGCHC	1 cut(s)	45
MmeI	TCCRAC	1 cut(s)	16
MnlI	CCTC	5 cut(s)	16, 32, 58, 80, 180
MspI	CCGG	1 cut(s)	135
MspR9I	CCNGG	1 cut(s)	49
MvaI	CCWGG	1 cut(s)	49
MvnI	CGCG	2 cut(s)	129, 194
NdeII	GATC	4 cut(s)	15, 99, 114, 195
NlaIII	CATG	2 cut(s)	187, 208
NmeAIII	GCCGAG	1 cut(s)	37
NmuCI	GTSAC	1 cut(s)	160
PcsI	WCGNNNNNNNCGW	1 cut(s)	69
PfeI	GAWTC	3 cut(s)	107, 150, 156
Ple19I	CGATCG	1 cut(s)	198
Psp6I	CCWGG	1 cut(s)	47
PspGI	CCWGG	1 cut(s)	47
PspPI	GGNCC	3 cut(s)	51, 67, 78
PvuI	CGATCG	1 cut(s)	198
Sau3AI	GATC	4 cut(s)	15, 99, 114, 195
Sau96I	GGNCC	3 cut(s)	51, 67, 78
ScrFI	CCNGG	1 cut(s)	49
SduI	GDGCHC	1 cut(s)	45
SetI	ASST	2 cut(s)	143, 167
SsiI	CCGC	1 cut(s)	127
StyD4I	CCNGG	1 cut(s)	47
TaqI	TCGA	5 cut(s)	18, 72, 105, 110, 198
TfiI	GAWTC	3 cut(s)	107, 150, 156
TseFI	GTSAC	1 cut(s)	160
Tsp45I	GTSAC	1 cut(s)	160
TspGWI	ACGGA	1 cut(s)	14

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.