RLG00000016608

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
OG0008378
Physical Location & Seq
Forward (+)
8184884 .. 8186395
1512 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000016608

Sequence Viewer

Length: 615 bp
ATGGGAAGAGAGGCTCCACAGCAAACGCCGCCGTCCCCGCAGCAGCAGCAGCAGCAGCAAGTGTCGTTCACGGTGGAGCAATTGGTCGCCGTCAATCCCTACAACCCCGATATCCTCCCCGATCTCGAAAGCTACGTCAACGAACAGGCACTGATGGCAATGCCCGCTCCTGATTTCAGCCTTTGTCTCTTCCTAATTCCAGAAAGAGTGCAAATGGAGGAGCAGTTCAAGACACTAATTGTCCTATCTCACTATCTAGAGACAGGAAGATTCAGTCAATTCTGGGATGAAGCATCTAAGAATCGTCACATACTTGAAGCTGTCCCAGGATTTGAGCAAGCGGTCCAAGCCTATGCAGTTCATGTTCTTTCCTTGACTTACCAAAAGGTTCCCAGATCTGTGCTTGCTGAGGCAATCAACCTTGAAGGTATATCCTTGGACAAATTCCTTGAGCATCATGTGGCCAATAGCGGTTGGGTTCTTGAAAAAGGTCATGGCAAGGGCCAACTCATTGTCTTACCTCGAAATGAATTTAACCATCCCGAGCTGAAGAAAAGCACGGACGATGGAATTCCATTAGACCATGTGGCTCGAATCTTCCCCATCCTGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005852 GO:0032991 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CSN8_PSD8_EIF3K

Protein Analysis

205

Amino Acids

23.05

Weight (kDa)

5.2

Isoelectric Point (pI)

44.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CSN8_PSD8_EIF3K PF10075 50 - 164 2e-13 CSN8/PSMD8/EIF3K family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 167
AciI CCGC 5 cut(s) 29, 38, 165, 341, 471
AcoI YGGCCR 1 cut(s) 462
AcsI RAATTY 3 cut(s) 443, 530, 570
AcuI CTGAAG 1 cut(s) 569
AfiI CCNNNNNNNGG 2 cut(s) 607, 608
AgsI TTSAA 4 cut(s) 229, 317, 425, 485
AjnI CCWGG 2 cut(s) 325, 606
AloI GAACNNNNNNTCC 2 cut(s) 209, 241
AluBI AGCT 3 cut(s) 132, 320, 547
AluI AGCT 3 cut(s) 132, 320, 547
Alw26I GTCTC 2 cut(s) 191, 254
AlwNI CAGNNNCTG 1 cut(s) 151
Ama87I CYCGRG 1 cut(s) 542
AoxI GGCC 2 cut(s) 462, 502
ApeKI GCWGC 6 cut(s) 40, 43, 46, 49, 52, 55
ApoI RAATTY 3 cut(s) 443, 530, 570
ArsI GACNNNNNNTTYG 2 cut(s) 120, 152
AspS9I GGNCC 2 cut(s) 343, 502
AvaI CYCGRG 1 cut(s) 542
AvaII GGWCC 1 cut(s) 343
BalI TGGCCA 1 cut(s) 464
BbvCI CCTCAGC 1 cut(s) 408
BbvI GCAGC 6 cut(s) 52, 55, 58, 61, 64, 67
BccI CCATC 4 cut(s) 148, 546, 560, 611
BceAI ACGGC 2 cut(s) 16, 74
BciT130I CCWGG 2 cut(s) 327, 608
BcoDI GTCTC 2 cut(s) 191, 254
BfaI CTAG 1 cut(s) 257
BglII AGATCT 1 cut(s) 395
BisI GCNGC 7 cut(s) 29, 41, 44, 47, 50, 53, 56
BlsI GCNGC 7 cut(s) 30, 42, 45, 48, 51, 54, 57
Bme1390I CCNGG 2 cut(s) 327, 608
Bme18I GGWCC 1 cut(s) 343
BmeT110I CYCGRG 1 cut(s) 542
BmgT120I GGNCC 2 cut(s) 343, 502
BmiI GGNNCC 2 cut(s) 15, 390
BmrFI CCNGG 2 cut(s) 327, 608
BmsI GCATC 2 cut(s) 302, 463
Bpu10I CCTNAGC 1 cut(s) 408
BpuEI CTTGAG 1 cut(s) 470
BsaJI CCNNGG 3 cut(s) 325, 435, 607
BsaXI ACNNNNNCTCC 2 cut(s) 209, 239
Bsc4I CCNNNNNNNGG 2 cut(s) 607, 608
Bse3DI GCAATG 1 cut(s) 165
BseBI CCWGG 2 cut(s) 327, 608
BseDI CCNNGG 3 cut(s) 325, 435, 607
BseGI GGATG 3 cut(s) 292, 538, 603
BseLI CCNNNNNNNGG 2 cut(s) 607, 608
BseMI GCAATG 1 cut(s) 165
BseMII CTCAG 1 cut(s) 399
BseRI GAGGAG 1 cut(s) 233
BseXI GCAGC 6 cut(s) 52, 55, 58, 61, 64, 67
BshFI GGCC 2 cut(s) 464, 504
BsiHKCI CYCGRG 1 cut(s) 542
BslFI GGGAC 2 cut(s) 19, 308
BslI CCNNNNNNNGG 2 cut(s) 607, 608
BsmAI GTCTC 2 cut(s) 191, 254
BsmFI GGGAC 2 cut(s) 19, 308
BsnI GGCC 2 cut(s) 464, 504
BsoBI CYCGRG 1 cut(s) 542
Bsp143I GATC 2 cut(s) 121, 395
BspACI CCGC 5 cut(s) 29, 38, 165, 341, 471
BspANI GGCC 2 cut(s) 464, 504
BspCNI CTCAG 1 cut(s) 400
BspLI GGNNCC 2 cut(s) 15, 390
BsrBI CCGCTC 1 cut(s) 167
BsrDI GCAATG 1 cut(s) 165
BssECI CCNNGG 3 cut(s) 325, 435, 607
BssMI GATC 2 cut(s) 121, 395
BssT1I CCWWGG 1 cut(s) 435
Bst2UI CCWGG 2 cut(s) 327, 608
Bst4CI ACNGT 1 cut(s) 73
Bst6I CTCTTC 1 cut(s) 194
BstC8I GCNNGC 3 cut(s) 165, 339, 405
BstDEI CTNAG 2 cut(s) 297, 408
BstF5I GGATG 3 cut(s) 292, 538, 603
BstKTI GATC 2 cut(s) 124, 398
BstMAI GTCTC 2 cut(s) 191, 254
BstMBI GATC 2 cut(s) 121, 395
BstMWI GCNNNNNNNGC 9 cut(s) 28, 37, 46, 49, 52, 55, 155, 164, 347
BstNI CCWGG 2 cut(s) 327, 608
BstSCI CCNGG 2 cut(s) 325, 606
BstV1I GCAGC 6 cut(s) 52, 55, 58, 61, 64, 67
BstX2I RGATCY 1 cut(s) 395
BstYI RGATCY 1 cut(s) 395
BsuRI GGCC 2 cut(s) 464, 504
BtsCI GGATG 3 cut(s) 292, 538, 603
BtsIMutI CAGTG 1 cut(s) 149
Cac8I GCNNGC 3 cut(s) 165, 339, 405
CaiI CAGNNNCTG 1 cut(s) 151
Cfr13I GGNCC 2 cut(s) 343, 502
CviAII CATG 4 cut(s) 362, 458, 494, 584
CviJI RGCY 9 cut(s) 14, 132, 180, 320, 350, 464, 504, 547, 590
CviKI_1 RGCY 9 cut(s) 14, 132, 180, 320, 350, 464, 504, 547, 590
DdeI CTNAG 2 cut(s) 297, 408
DpnI GATC 2 cut(s) 123, 397
DpnII GATC 2 cut(s) 121, 395
EaeI YGGCCR 1 cut(s) 462
Eam1104I CTCTTC 1 cut(s) 194
EarI CTCTTC 1 cut(s) 194
Eco130I CCWWGG 1 cut(s) 435
Eco32I GATATC 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 343
Eco57I CTGAAG 1 cut(s) 569
Eco88I CYCGRG 1 cut(s) 542
EcoRI GAATTC 1 cut(s) 570
EcoRII CCWGG 2 cut(s) 325, 606
EcoRV GATATC 1 cut(s) 112
EcoT14I CCWWGG 1 cut(s) 435
ErhI CCWWGG 1 cut(s) 435
FaeI CATG 4 cut(s) 365, 461, 497, 587
FaiI YATR 7 cut(s) 311, 354, 363, 431, 459, 495, 585
FaqI GGGAC 2 cut(s) 19, 308
FatI CATG 4 cut(s) 361, 457, 493, 583
FauI CCCGC 2 cut(s) 45, 172
Fnu4HI GCNGC 7 cut(s) 29, 41, 44, 47, 50, 53, 56
FokI GGATG 3 cut(s) 299, 525, 590
Fsp4HI GCNGC 7 cut(s) 29, 41, 44, 47, 50, 53, 56
FspBI CTAG 1 cut(s) 257
GluI GCNGC 7 cut(s) 29, 41, 44, 47, 50, 53, 56
HaeIII GGCC 2 cut(s) 464, 504
Hin1II CATG 4 cut(s) 365, 461, 497, 587
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HinfI GANTC 3 cut(s) 270, 301, 594
Hpy166II GTNNAC 2 cut(s) 69, 139
Hpy188III TCNNGA 7 cut(s) 125, 170, 200, 229, 257, 482, 542
Hpy8I GTNNAC 2 cut(s) 69, 139
HpyAV CCTTC 1 cut(s) 419
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4IV ACGT 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 211, 356
HpyF10VI GCNNNNNNNGC 9 cut(s) 28, 37, 46, 49, 52, 55, 155, 164, 347
HpyF3I CTNAG 2 cut(s) 297, 408
HpySE526I ACGT 1 cut(s) 135
Hsp92II CATG 4 cut(s) 365, 461, 497, 587
Kzo9I GATC 2 cut(s) 121, 395
LmnI GCTCC 4 cut(s) 19, 76, 172, 220
LpnPI CCDG 9 cut(s) 131, 183, 213, 249, 268, 312, 339, 406, 593
Lsp1109I GCAGC 6 cut(s) 52, 55, 58, 61, 64, 67
LweI GCATC 2 cut(s) 302, 463
MaeI CTAG 1 cut(s) 257
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 305
MalI GATC 2 cut(s) 123, 397
MbiI CCGCTC 1 cut(s) 167
MboI GATC 2 cut(s) 121, 395
MboII GAAGA 5 cut(s) 18, 181, 279, 562, 589
MfeI CAATTG 1 cut(s) 80
MflI RGATCY 1 cut(s) 395
MlsI TGGCCA 1 cut(s) 464
MluCI AATT 7 cut(s) 80, 195, 237, 278, 443, 530, 570
MluNI TGGCCA 1 cut(s) 464
MnlI CCTC 5 cut(s) 4, 125, 211, 403, 531
Mox20I TGGCCA 1 cut(s) 464
MscI TGGCCA 1 cut(s) 464
MseI TTAA 1 cut(s) 534
Msp20I TGGCCA 1 cut(s) 464
MspR9I CCNGG 2 cut(s) 327, 608
MunI CAATTG 1 cut(s) 80
MvaI CCWGG 2 cut(s) 327, 608
MwoI GCNNNNNNNGC 9 cut(s) 28, 37, 46, 49, 52, 55, 155, 164, 347
NdeII GATC 2 cut(s) 121, 395
NlaIII CATG 4 cut(s) 365, 461, 497, 587
NlaIV GGNNCC 2 cut(s) 15, 390
NmuCI GTSAC 1 cut(s) 305
PcsI WCGNNNNNNNCGW 1 cut(s) 132
PfeI GAWTC 3 cut(s) 270, 301, 594
PkrI GCNGC 7 cut(s) 30, 42, 45, 48, 51, 54, 57
Psp6I CCWGG 2 cut(s) 325, 606
PspGI CCWGG 2 cut(s) 325, 606
PspN4I GGNNCC 2 cut(s) 15, 390
PspPI GGNCC 2 cut(s) 343, 502
PstNI CAGNNNCTG 1 cut(s) 151
PsuI RGATCY 1 cut(s) 395
SaqAI TTAA 1 cut(s) 534
SatI GCNGC 7 cut(s) 29, 41, 44, 47, 50, 53, 56
Sau3AI GATC 2 cut(s) 121, 395
Sau96I GGNCC 2 cut(s) 343, 502
ScrFI CCNGG 2 cut(s) 327, 608
SetI ASST 9 cut(s) 134, 138, 322, 390, 423, 430, 493, 523, 549
SfaNI GCATC 2 cut(s) 302, 463
SinI GGWCC 1 cut(s) 343
SmlI CTYRAG 1 cut(s) 449
SmoI CTYRAG 1 cut(s) 449
Sse9I AATT 7 cut(s) 80, 195, 237, 278, 443, 530, 570
SsiI CCGC 5 cut(s) 29, 38, 165, 341, 471
SspMI CTAG 1 cut(s) 257
StyD4I CCNGG 2 cut(s) 325, 606
StyI CCWWGG 1 cut(s) 435
TaaI ACNGT 1 cut(s) 73
TaiI ACGT 1 cut(s) 138
TaqI TCGA 3 cut(s) 126, 523, 592
TasI AATT 7 cut(s) 80, 195, 237, 278, 443, 530, 570
TauI GCSGC 1 cut(s) 31
TfiI GAWTC 3 cut(s) 270, 301, 594
Tru1I TTAA 1 cut(s) 534
Tru9I TTAA 1 cut(s) 534
TscAI CASTG 1 cut(s) 156
TseFI GTSAC 1 cut(s) 305
TseI GCWGC 6 cut(s) 40, 43, 46, 49, 52, 55
Tsp45I GTSAC 1 cut(s) 305
TspDTI ATGAA 3 cut(s) 303, 350, 543
TspGWI ACGGA 1 cut(s) 575
TspRI CASTG 1 cut(s) 156
VpaK11BI GGWCC 1 cut(s) 343
XapI RAATTY 3 cut(s) 443, 530, 570
XbaI TCTAGA 1 cut(s) 256
XspI CTAG 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.