Rmu_sc0036421.1_g000001

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036421.1
Physical Location & Seq
Forward (+)
1 .. 436
436 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036421.1_g000001.1.cds

Sequence Viewer

Length: 186 bp
gtttcgtcacagacctacagtctcgatgcgaatctctgccttcttcgtctctatcagtttgagccggagcgtatgagcactcaaattgttgctcgtattttggttaaggcactgatggcaatgcccgctcccgatttcagcctctgtctcttcctaattccagaaagagtggtattattctcgtaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.95

Weight (kDa)

6.24

Isoelectric Point (pI)

53.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 128
AciI CCGC 1 cut(s) 126
AhdI GACNNNNNGTC 1 cut(s) 18
Alw21I GWGCWC 1 cut(s) 80
Alw26I GTCTC 3 cut(s) 26, 53, 152
AlwNI CAGNNNCTG 1 cut(s) 144
Bbv12I GWGCWC 1 cut(s) 80
BccI CCATC 1 cut(s) 109
BcoDI GTCTC 3 cut(s) 26, 53, 152
BfmI CTRYAG 1 cut(s) 16
BmeRI GACNNNNNGTC 1 cut(s) 18
BmsI GCATC 1 cut(s) 16
BsaBI GATNNNNATC 1 cut(s) 30
Bse3DI GCAATG 1 cut(s) 126
Bse8I GATNNNNATC 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 30
BseMI GCAATG 1 cut(s) 126
BsiHKAI GWGCWC 1 cut(s) 80
BsiSI CCGG 1 cut(s) 65
BsmAI GTCTC 3 cut(s) 26, 53, 152
BsmBI CGTCTC 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 80
BspACI CCGC 1 cut(s) 126
BsrBI CCGCTC 1 cut(s) 128
BsrDI GCAATG 1 cut(s) 126
Bst4CI ACNGT 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 126
BstMAI GTCTC 3 cut(s) 26, 53, 152
BstMWI GCNNNNNNNGC 2 cut(s) 116, 125
BstSFI CTRYAG 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 110
Cac8I GCNNGC 1 cut(s) 126
CaiI CAGNNNCTG 1 cut(s) 144
CviJI RGCY 2 cut(s) 64, 141
CviKI_1 RGCY 2 cut(s) 64, 141
DriI GACNNNNNGTC 1 cut(s) 18
Eam1104I CTCTTC 1 cut(s) 155
Eam1105I GACNNNNNGTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 155
Esp3I CGTCTC 1 cut(s) 53
FaiI YATR 1 cut(s) 74
FauI CCCGC 1 cut(s) 133
HapII CCGG 1 cut(s) 65
HinfI GANTC 1 cut(s) 31
HpaII CCGG 1 cut(s) 65
Hpy188III TCNNGA 3 cut(s) 23, 131, 161
HpyAV CCTTC 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 20
HpyF10VI GCNNNNNNNGC 2 cut(s) 116, 125
LmnI GCTCC 2 cut(s) 67, 133
LpnPI CCDG 2 cut(s) 78, 174
LweI GCATC 1 cut(s) 16
MaeIII GTNAC 1 cut(s) 6
MbiI CCGCTC 1 cut(s) 128
MboII GAAGA 2 cut(s) 35, 142
MhlI GDGCHC 1 cut(s) 80
MluCI AATT 2 cut(s) 84, 156
MnlI CCTC 1 cut(s) 152
MseI TTAA 1 cut(s) 105
MspI CCGG 1 cut(s) 65
MwoI GCNNNNNNNGC 2 cut(s) 116, 125
NmuCI GTSAC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 31
PstNI CAGNNNCTG 1 cut(s) 144
SaqAI TTAA 1 cut(s) 105
SduI GDGCHC 1 cut(s) 80
SetI ASST 1 cut(s) 17
SfaNI GCATC 1 cut(s) 16
SfcI CTRYAG 1 cut(s) 16
SgeI CNNG 6 cut(s) 35, 77, 105, 137, 143, 173
Sse9I AATT 2 cut(s) 84, 156
SsiI CCGC 1 cut(s) 126
TaaI ACNGT 1 cut(s) 20
TaqI TCGA 1 cut(s) 24
TasI AATT 2 cut(s) 84, 156
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 1 cut(s) 117
TseFI GTSAC 1 cut(s) 6
Tsp45I GTSAC 1 cut(s) 6
TspRI CASTG 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.