Rmu_sc0002497.1_g000001

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002497.1
OG0008378
Physical Location & Seq
Forward (+)
1 .. 1336
1336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002497.1_g000001.1.cds

Sequence Viewer

Length: 576 bp
gtctcgtcgcagacctacagtctcgatgcgaatctctgccttcttcgtctctatcagtttgagccggagcgtatgagcactcaaattgttgctcgtattttggttaaggcactgatggcaatgcccgctcccgatttcagcctctgtctcttcctaattccagaaagagtgcaaatggaggagcagttcaagactctaattgtcctatctcactatctagagacaggaagattcagtcaattctgggatgatgcatctaagaatcgtcacatacttgaagctgtcccaggttttgagcaagcggtccaagcctatgcagttcatgttctttccttgacttaccaaaaggttcccagatctgtgcttgctgaggcaatcaaccttgaaggtatatccttggacaaattccttgagcatcatgttgccaatagcggttgggttcttgaaaaaggtcatggcaagggccaactcattgtcttacctcgaaatgaatttaaccatcctgagctgaagaaaagcactgacgatggaattccattagaccatgtggctcgaatcttccccatcctgggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005852 GO:0032991 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CSN8_PSD8_EIF3K

Protein Analysis

191

Amino Acids

21.65

Weight (kDa)

6.06

Isoelectric Point (pI)

36.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 128
AciI CCGC 3 cut(s) 126, 302, 432
AcsI RAATTY 3 cut(s) 404, 491, 531
AcuI CTGAAG 1 cut(s) 530
AfiI CCNNNNNNNGG 2 cut(s) 568, 569
AgsI TTSAA 4 cut(s) 190, 278, 386, 446
AhdI GACNNNNNGTC 1 cut(s) 18
AjnI CCWGG 2 cut(s) 286, 567
AloI GAACNNNNNNTCC 2 cut(s) 170, 202
AluBI AGCT 2 cut(s) 281, 508
AluI AGCT 2 cut(s) 281, 508
Alw21I GWGCWC 1 cut(s) 80
Alw26I GTCTC 5 cut(s) 7, 26, 53, 152, 215
AlwNI CAGNNNCTG 1 cut(s) 144
AoxI GGCC 1 cut(s) 463
ApoI RAATTY 3 cut(s) 404, 491, 531
AspS9I GGNCC 2 cut(s) 304, 463
AvaII GGWCC 1 cut(s) 304
Bbv12I GWGCWC 1 cut(s) 80
BbvCI CCTCAGC 1 cut(s) 369
BccI CCATC 4 cut(s) 109, 507, 521, 572
BciT130I CCWGG 2 cut(s) 288, 569
BcoDI GTCTC 5 cut(s) 7, 26, 53, 152, 215
BfaI CTAG 1 cut(s) 218
BfmI CTRYAG 1 cut(s) 16
BglII AGATCT 1 cut(s) 356
Bme1390I CCNGG 2 cut(s) 288, 569
Bme18I GGWCC 1 cut(s) 304
BmeRI GACNNNNNGTC 1 cut(s) 18
BmgT120I GGNCC 2 cut(s) 304, 463
BmiI GGNNCC 1 cut(s) 351
BmrFI CCNGG 2 cut(s) 288, 569
BmsI GCATC 4 cut(s) 16, 241, 263, 424
Bpu10I CCTNAGC 2 cut(s) 369, 504
BpuEI CTTGAG 1 cut(s) 431
BsaBI GATNNNNATC 1 cut(s) 30
BsaJI CCNNGG 3 cut(s) 286, 396, 568
BsaXI ACNNNNNCTCC 2 cut(s) 170, 200
Bsc4I CCNNNNNNNGG 2 cut(s) 568, 569
Bse3DI GCAATG 1 cut(s) 126
Bse8I GATNNNNATC 1 cut(s) 30
BseBI CCWGG 2 cut(s) 288, 569
BseDI CCNNGG 3 cut(s) 286, 396, 568
BseGI GGATG 3 cut(s) 253, 499, 564
BseJI GATNNNNATC 1 cut(s) 30
BseLI CCNNNNNNNGG 2 cut(s) 568, 569
BseMI GCAATG 1 cut(s) 126
BseMII CTCAG 2 cut(s) 360, 495
BseRI GAGGAG 1 cut(s) 194
BshFI GGCC 1 cut(s) 465
BsiHKAI GWGCWC 1 cut(s) 80
BsiSI CCGG 1 cut(s) 65
BslFI GGGAC 1 cut(s) 269
BslI CCNNNNNNNGG 2 cut(s) 568, 569
BsmAI GTCTC 5 cut(s) 7, 26, 53, 152, 215
BsmBI CGTCTC 1 cut(s) 53
BsmFI GGGAC 1 cut(s) 269
BsnI GGCC 1 cut(s) 465
Bsp1286I GDGCHC 1 cut(s) 80
Bsp143I GATC 1 cut(s) 356
BspACI CCGC 3 cut(s) 126, 302, 432
BspANI GGCC 1 cut(s) 465
BspCNI CTCAG 2 cut(s) 361, 496
BspLI GGNNCC 1 cut(s) 351
BsrBI CCGCTC 1 cut(s) 128
BsrDI GCAATG 1 cut(s) 126
BssECI CCNNGG 3 cut(s) 286, 396, 568
BssMI GATC 1 cut(s) 356
BssT1I CCWWGG 1 cut(s) 396
Bst2UI CCWGG 2 cut(s) 288, 569
Bst4CI ACNGT 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 155
BstC8I GCNNGC 3 cut(s) 126, 300, 366
BstDEI CTNAG 3 cut(s) 258, 369, 504
BstF5I GGATG 3 cut(s) 253, 499, 564
BstKTI GATC 1 cut(s) 359
BstMAI GTCTC 5 cut(s) 7, 26, 53, 152, 215
BstMBI GATC 1 cut(s) 356
BstMWI GCNNNNNNNGC 3 cut(s) 116, 125, 308
BstNI CCWGG 2 cut(s) 288, 569
BstSCI CCNGG 2 cut(s) 286, 567
BstSFI CTRYAG 1 cut(s) 16
BstX2I RGATCY 1 cut(s) 356
BstYI RGATCY 1 cut(s) 356
BsuRI GGCC 1 cut(s) 465
BtsCI GGATG 3 cut(s) 253, 499, 564
BtsIMutI CAGTG 2 cut(s) 110, 519
Cac8I GCNNGC 3 cut(s) 126, 300, 366
CaiI CAGNNNCTG 1 cut(s) 144
Cfr13I GGNCC 2 cut(s) 304, 463
CviAII CATG 4 cut(s) 323, 419, 455, 545
CviJI RGCY 7 cut(s) 64, 141, 281, 311, 465, 508, 551
CviKI_1 RGCY 7 cut(s) 64, 141, 281, 311, 465, 508, 551
DdeI CTNAG 3 cut(s) 258, 369, 504
DpnI GATC 1 cut(s) 358
DpnII GATC 1 cut(s) 356
DriI GACNNNNNGTC 1 cut(s) 18
Eam1104I CTCTTC 1 cut(s) 155
Eam1105I GACNNNNNGTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 155
Eco130I CCWWGG 1 cut(s) 396
Eco47I GGWCC 1 cut(s) 304
Eco57I CTGAAG 1 cut(s) 530
EcoRI GAATTC 1 cut(s) 531
EcoRII CCWGG 2 cut(s) 286, 567
EcoT14I CCWWGG 1 cut(s) 396
EcoT22I ATGCAT 1 cut(s) 256
ErhI CCWWGG 1 cut(s) 396
Esp3I CGTCTC 1 cut(s) 53
FaeI CATG 4 cut(s) 326, 422, 458, 548
FaiI YATR 8 cut(s) 74, 272, 315, 324, 392, 420, 456, 546
FaqI GGGAC 1 cut(s) 269
FatI CATG 4 cut(s) 322, 418, 454, 544
FauI CCCGC 1 cut(s) 133
FokI GGATG 3 cut(s) 260, 486, 551
FspBI CTAG 1 cut(s) 218
HaeIII GGCC 1 cut(s) 465
HapII CCGG 1 cut(s) 65
Hin1II CATG 4 cut(s) 326, 422, 458, 548
HinfI GANTC 5 cut(s) 31, 193, 231, 262, 555
HpaII CCGG 1 cut(s) 65
Hpy188III TCNNGA 7 cut(s) 23, 131, 161, 190, 218, 443, 503
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 2 cut(s) 50, 380
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 3 cut(s) 172, 254, 317
HpyF10VI GCNNNNNNNGC 3 cut(s) 116, 125, 308
HpyF3I CTNAG 3 cut(s) 258, 369, 504
Hsp92II CATG 4 cut(s) 326, 422, 458, 548
Kzo9I GATC 1 cut(s) 356
LmnI GCTCC 3 cut(s) 67, 133, 181
LpnPI CCDG 9 cut(s) 78, 174, 210, 229, 273, 300, 367, 516, 554
LweI GCATC 4 cut(s) 16, 241, 263, 424
MaeI CTAG 1 cut(s) 218
MaeIII GTNAC 1 cut(s) 266
MalI GATC 1 cut(s) 358
MbiI CCGCTC 1 cut(s) 128
MboI GATC 1 cut(s) 356
MboII GAAGA 5 cut(s) 35, 142, 240, 523, 550
MflI RGATCY 1 cut(s) 356
MhlI GDGCHC 1 cut(s) 80
MluCI AATT 7 cut(s) 84, 156, 198, 239, 404, 491, 531
MlyI GAGTC 1 cut(s) 187
MnlI CCTC 4 cut(s) 152, 172, 364, 492
Mph1103I ATGCAT 1 cut(s) 256
MseI TTAA 2 cut(s) 105, 495
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 288, 569
MvaI CCWGG 2 cut(s) 288, 569
MwoI GCNNNNNNNGC 3 cut(s) 116, 125, 308
NdeII GATC 1 cut(s) 356
NlaIII CATG 4 cut(s) 326, 422, 458, 548
NlaIV GGNNCC 1 cut(s) 351
NmuCI GTSAC 1 cut(s) 266
NsiI ATGCAT 1 cut(s) 256
PfeI GAWTC 4 cut(s) 31, 231, 262, 555
PleI GAGTC 1 cut(s) 187
PpsI GAGTC 1 cut(s) 187
Psp6I CCWGG 2 cut(s) 286, 567
PspGI CCWGG 2 cut(s) 286, 567
PspN4I GGNNCC 1 cut(s) 351
PspPI GGNCC 2 cut(s) 304, 463
PstNI CAGNNNCTG 1 cut(s) 144
PsuI RGATCY 1 cut(s) 356
SaqAI TTAA 2 cut(s) 105, 495
Sau3AI GATC 1 cut(s) 356
Sau96I GGNCC 2 cut(s) 304, 463
SchI GAGTC 1 cut(s) 187
ScrFI CCNGG 2 cut(s) 288, 569
SduI GDGCHC 1 cut(s) 80
SetI ASST 9 cut(s) 17, 283, 292, 351, 384, 391, 454, 484, 510
SfaNI GCATC 4 cut(s) 16, 241, 263, 424
SfcI CTRYAG 1 cut(s) 16
SinI GGWCC 1 cut(s) 304
SmlI CTYRAG 1 cut(s) 410
SmoI CTYRAG 1 cut(s) 410
Sse9I AATT 7 cut(s) 84, 156, 198, 239, 404, 491, 531
SsiI CCGC 3 cut(s) 126, 302, 432
SspMI CTAG 1 cut(s) 218
StyD4I CCNGG 2 cut(s) 286, 567
StyI CCWWGG 1 cut(s) 396
TaaI ACNGT 1 cut(s) 20
TaqI TCGA 3 cut(s) 24, 484, 553
TasI AATT 7 cut(s) 84, 156, 198, 239, 404, 491, 531
TfiI GAWTC 4 cut(s) 31, 231, 262, 555
Tru1I TTAA 2 cut(s) 105, 495
Tru9I TTAA 2 cut(s) 105, 495
TscAI CASTG 2 cut(s) 117, 526
TseFI GTSAC 1 cut(s) 266
Tsp45I GTSAC 1 cut(s) 266
TspDTI ATGAA 2 cut(s) 311, 504
TspRI CASTG 2 cut(s) 117, 526
VpaK11BI GGWCC 1 cut(s) 304
XapI RAATTY 3 cut(s) 404, 491, 531
XbaI TCTAGA 1 cut(s) 217
XspI CTAG 1 cut(s) 218
Zsp2I ATGCAT 1 cut(s) 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.