Rroxscaffold_2G00145940

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0008378
Physical Location & Seq
Reverse (-)
83796377 .. 83798139
1763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00145940.1

Sequence Viewer

Length: 711 bp
ATGGGAAGAGAGGCTCCACAGAAAACGCCGCCGTCGCCGCAGCAGCAAGTGTCGTTCACGGTGGAGCAATTGGTCGCCGTCAATCCCTACAACCCCGATATCCTCCCCGATCTCGAAAGCTACGTCAACGAGCAGGTTTCGTCACAGACCTACAGTCTCGATGCGAATCTCTGCCTTCTTCGTCTCTATCAGTTTGAGCCGGAGCGTATGAGCACTCAAATTGTTGCTCGTATTTTGGTTAAGGCACTGATGGCAATGCCCGCTCCCGATTTCAGCCTTTGTCTCTTCCTAATTCCAGAAAGAGTGCAAATGGAGGAGCAGTTCAAGACACTAATTGTCCTATCTCACTATCTAGAGACAGGAAGATTCAGTCAATTCTGGGATGAAGCATCTAAGAATCGTCACATACTTGAAGCTGTCCCAGGTTTTGAGCAAGCGGTCCAAGCCTATGCAGTTCATGTTCTTTCCTTGACTTACCAAAAGGTTCCCAGATCTGTGCTTGCTGAGGCAATCAACCTTGAAGGTATATCCTTGGACAAATTCCTTGAGCATCATGTGGCCAATAGCGGTTGGGTTCTTGAAAAAGGTCATGGCAAGGGCCAACTCATTGTCTTACCTCGAAATGAATTTAACCATCCTGAGCTGAAGAAAAGCACAGACGATGGAATTCCATTAGACCATGTGGCTCGAATCTTCCCCATCCTGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005852 GO:0032991 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CSN8_PSD8_EIF3K

Protein Analysis

236

Amino Acids

26.7

Weight (kDa)

5.48

Isoelectric Point (pI)

41.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CSN8_PSD8_EIF3K PF10075 71 - 196 1.3e-16 CSN8/PSMD8/EIF3K family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 124
AccBSI CCGCTC 1 cut(s) 263
AciI CCGC 5 cut(s) 29, 38, 261, 437, 567
AcoI YGGCCR 1 cut(s) 558
AcsI RAATTY 3 cut(s) 539, 626, 666
AcuI CTGAAG 1 cut(s) 665
AfiI CCNNNNNNNGG 2 cut(s) 703, 704
AgsI TTSAA 4 cut(s) 325, 413, 521, 581
AhdI GACNNNNNGTC 1 cut(s) 153
AjnI CCWGG 2 cut(s) 421, 702
AloI GAACNNNNNNTCC 2 cut(s) 305, 337
AluBI AGCT 3 cut(s) 120, 416, 643
AluI AGCT 3 cut(s) 120, 416, 643
Alw21I GWGCWC 1 cut(s) 215
Alw26I GTCTC 4 cut(s) 161, 188, 287, 350
AoxI GGCC 2 cut(s) 558, 598
ApeKI GCWGC 2 cut(s) 40, 43
ApoI RAATTY 3 cut(s) 539, 626, 666
ArsI GACNNNNNNTTYG 2 cut(s) 108, 140
AspS9I GGNCC 2 cut(s) 439, 598
AvaII GGWCC 1 cut(s) 439
BalI TGGCCA 1 cut(s) 560
Bbv12I GWGCWC 1 cut(s) 215
BbvCI CCTCAGC 1 cut(s) 504
BbvI GCAGC 2 cut(s) 52, 55
BccI CCATC 4 cut(s) 244, 642, 656, 707
BceAI ACGGC 2 cut(s) 16, 62
BciT130I CCWGG 2 cut(s) 423, 704
BcoDI GTCTC 4 cut(s) 161, 188, 287, 350
BfaI CTAG 1 cut(s) 353
BfmI CTRYAG 1 cut(s) 151
BfuAI ACCTGC 1 cut(s) 124
BglII AGATCT 1 cut(s) 491
BisI GCNGC 4 cut(s) 29, 38, 41, 44
BlsI GCNGC 4 cut(s) 30, 39, 42, 45
Bme1390I CCNGG 2 cut(s) 423, 704
Bme18I GGWCC 1 cut(s) 439
BmeRI GACNNNNNGTC 1 cut(s) 153
BmgT120I GGNCC 2 cut(s) 439, 598
BmiI GGNNCC 2 cut(s) 15, 486
BmrFI CCNGG 2 cut(s) 423, 704
BmsI GCATC 3 cut(s) 151, 398, 559
Bpu10I CCTNAGC 2 cut(s) 504, 639
BpuEI CTTGAG 1 cut(s) 566
BsaBI GATNNNNATC 1 cut(s) 165
BsaJI CCNNGG 3 cut(s) 421, 531, 703
BsaXI ACNNNNNCTCC 2 cut(s) 305, 335
Bsc4I CCNNNNNNNGG 2 cut(s) 703, 704
Bse3DI GCAATG 1 cut(s) 261
Bse8I GATNNNNATC 1 cut(s) 165
BseBI CCWGG 2 cut(s) 423, 704
BseDI CCNNGG 3 cut(s) 421, 531, 703
BseGI GGATG 3 cut(s) 388, 634, 699
BseJI GATNNNNATC 1 cut(s) 165
BseLI CCNNNNNNNGG 2 cut(s) 703, 704
BseMI GCAATG 1 cut(s) 261
BseMII CTCAG 2 cut(s) 495, 630
BseRI GAGGAG 1 cut(s) 329
BseXI GCAGC 2 cut(s) 52, 55
BshFI GGCC 2 cut(s) 560, 600
BsiHKAI GWGCWC 1 cut(s) 215
BsiSI CCGG 1 cut(s) 200
BslFI GGGAC 1 cut(s) 404
BslI CCNNNNNNNGG 2 cut(s) 703, 704
BsmAI GTCTC 4 cut(s) 161, 188, 287, 350
BsmBI CGTCTC 1 cut(s) 188
BsmFI GGGAC 1 cut(s) 404
BsnI GGCC 2 cut(s) 560, 600
Bsp1286I GDGCHC 1 cut(s) 215
Bsp143I GATC 2 cut(s) 109, 491
BspACI CCGC 5 cut(s) 29, 38, 261, 437, 567
BspANI GGCC 2 cut(s) 560, 600
BspCNI CTCAG 2 cut(s) 496, 631
BspLI GGNNCC 2 cut(s) 15, 486
BspMI ACCTGC 1 cut(s) 124
BsrBI CCGCTC 1 cut(s) 263
BsrDI GCAATG 1 cut(s) 261
BssECI CCNNGG 3 cut(s) 421, 531, 703
BssMI GATC 2 cut(s) 109, 491
BssT1I CCWWGG 1 cut(s) 531
Bst2UI CCWGG 2 cut(s) 423, 704
Bst4CI ACNGT 2 cut(s) 61, 155
Bst6I CTCTTC 1 cut(s) 290
BstC8I GCNNGC 3 cut(s) 261, 435, 501
BstDEI CTNAG 3 cut(s) 393, 504, 639
BstF5I GGATG 3 cut(s) 388, 634, 699
BstKTI GATC 2 cut(s) 112, 494
BstMAI GTCTC 4 cut(s) 161, 188, 287, 350
BstMBI GATC 2 cut(s) 109, 491
BstMWI GCNNNNNNNGC 6 cut(s) 34, 37, 43, 251, 260, 443
BstNI CCWGG 2 cut(s) 423, 704
BstSCI CCNGG 2 cut(s) 421, 702
BstSFI CTRYAG 1 cut(s) 151
BstV1I GCAGC 2 cut(s) 52, 55
BstX2I RGATCY 1 cut(s) 491
BstYI RGATCY 1 cut(s) 491
BsuRI GGCC 2 cut(s) 560, 600
BtsCI GGATG 3 cut(s) 388, 634, 699
BtsIMutI CAGTG 1 cut(s) 245
BveI ACCTGC 1 cut(s) 124
Cac8I GCNNGC 3 cut(s) 261, 435, 501
Cfr13I GGNCC 2 cut(s) 439, 598
CviAII CATG 4 cut(s) 458, 554, 590, 680
DdeI CTNAG 3 cut(s) 393, 504, 639
DpnI GATC 2 cut(s) 111, 493
DpnII GATC 2 cut(s) 109, 491
DriI GACNNNNNGTC 1 cut(s) 153
EaeI YGGCCR 1 cut(s) 558
Eam1104I CTCTTC 1 cut(s) 290
Eam1105I GACNNNNNGTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 290
Eco130I CCWWGG 1 cut(s) 531
Eco32I GATATC 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 439
Eco57I CTGAAG 1 cut(s) 665
EcoRI GAATTC 1 cut(s) 666
EcoRII CCWGG 2 cut(s) 421, 702
EcoRV GATATC 1 cut(s) 100
EcoT14I CCWWGG 1 cut(s) 531
ErhI CCWWGG 1 cut(s) 531
Esp3I CGTCTC 1 cut(s) 188
FaeI CATG 4 cut(s) 461, 557, 593, 683
FaiI YATR 8 cut(s) 209, 407, 450, 459, 527, 555, 591, 681
FaqI GGGAC 1 cut(s) 404
FatI CATG 4 cut(s) 457, 553, 589, 679
FauI CCCGC 1 cut(s) 268
Fnu4HI GCNGC 4 cut(s) 29, 38, 41, 44
FokI GGATG 3 cut(s) 395, 621, 686
Fsp4HI GCNGC 4 cut(s) 29, 38, 41, 44
FspBI CTAG 1 cut(s) 353
GluI GCNGC 4 cut(s) 29, 38, 41, 44
HaeIII GGCC 2 cut(s) 560, 600
HapII CCGG 1 cut(s) 200
Hin1II CATG 4 cut(s) 461, 557, 593, 683
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HinfI GANTC 4 cut(s) 166, 366, 397, 690
HpaII CCGG 1 cut(s) 200
Hpy166II GTNNAC 2 cut(s) 57, 127
Hpy188III TCNNGA 8 cut(s) 113, 158, 266, 296, 325, 353, 578, 638
Hpy8I GTNNAC 2 cut(s) 57, 127
Hpy99I CGWCG 1 cut(s) 37
HpyAV CCTTC 2 cut(s) 185, 515
HpyCH4III ACNGT 2 cut(s) 61, 155
HpyCH4IV ACGT 1 cut(s) 123
HpyCH4V TGCA 2 cut(s) 307, 452
HpyF10VI GCNNNNNNNGC 6 cut(s) 34, 37, 43, 251, 260, 443
HpyF3I CTNAG 3 cut(s) 393, 504, 639
HpySE526I ACGT 1 cut(s) 123
Hsp92II CATG 4 cut(s) 461, 557, 593, 683
Kzo9I GATC 2 cut(s) 109, 491
LmnI GCTCC 5 cut(s) 19, 64, 202, 268, 316
Lsp1109I GCAGC 2 cut(s) 52, 55
LweI GCATC 3 cut(s) 151, 398, 559
MaeI CTAG 1 cut(s) 353
MaeII ACGT 1 cut(s) 123
MaeIII GTNAC 2 cut(s) 141, 401
MalI GATC 2 cut(s) 111, 493
MbiI CCGCTC 1 cut(s) 263
MboI GATC 2 cut(s) 109, 491
MboII GAAGA 6 cut(s) 18, 170, 277, 375, 658, 685
MfeI CAATTG 1 cut(s) 68
MflI RGATCY 1 cut(s) 491
MhlI GDGCHC 1 cut(s) 215
MlsI TGGCCA 1 cut(s) 560
MluCI AATT 8 cut(s) 68, 219, 291, 333, 374, 539, 626, 666
MluNI TGGCCA 1 cut(s) 560
MnlI CCTC 5 cut(s) 4, 113, 307, 499, 627
Mox20I TGGCCA 1 cut(s) 560
MscI TGGCCA 1 cut(s) 560
MseI TTAA 2 cut(s) 240, 630
Msp20I TGGCCA 1 cut(s) 560
MspI CCGG 1 cut(s) 200
MspR9I CCNGG 2 cut(s) 423, 704
MunI CAATTG 1 cut(s) 68
MvaI CCWGG 2 cut(s) 423, 704
MwoI GCNNNNNNNGC 6 cut(s) 34, 37, 43, 251, 260, 443
NdeII GATC 2 cut(s) 109, 491
NlaIII CATG 4 cut(s) 461, 557, 593, 683
NlaIV GGNNCC 2 cut(s) 15, 486
NmuCI GTSAC 2 cut(s) 141, 401
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PfeI GAWTC 4 cut(s) 166, 366, 397, 690
PkrI GCNGC 4 cut(s) 30, 39, 42, 45
Psp6I CCWGG 2 cut(s) 421, 702
PspGI CCWGG 2 cut(s) 421, 702
PspN4I GGNNCC 2 cut(s) 15, 486
PspPI GGNCC 2 cut(s) 439, 598
PsuI RGATCY 1 cut(s) 491
SaqAI TTAA 2 cut(s) 240, 630
SatI GCNGC 4 cut(s) 29, 38, 41, 44
Sau3AI GATC 2 cut(s) 109, 491
Sau96I GGNCC 2 cut(s) 439, 598
ScrFI CCNGG 2 cut(s) 423, 704
SduI GDGCHC 1 cut(s) 215
SfaNI GCATC 3 cut(s) 151, 398, 559
SfcI CTRYAG 1 cut(s) 151
SinI GGWCC 1 cut(s) 439
SmlI CTYRAG 1 cut(s) 545
SmoI CTYRAG 1 cut(s) 545
Sse9I AATT 8 cut(s) 68, 219, 291, 333, 374, 539, 626, 666
SsiI CCGC 5 cut(s) 29, 38, 261, 437, 567
SspMI CTAG 1 cut(s) 353
StyD4I CCNGG 2 cut(s) 421, 702
StyI CCWWGG 1 cut(s) 531
TaaI ACNGT 2 cut(s) 61, 155
TaiI ACGT 1 cut(s) 126
TaqI TCGA 4 cut(s) 114, 159, 619, 688
TasI AATT 8 cut(s) 68, 219, 291, 333, 374, 539, 626, 666
TauI GCSGC 2 cut(s) 31, 40
TfiI GAWTC 4 cut(s) 166, 366, 397, 690
Tru1I TTAA 2 cut(s) 240, 630
Tru9I TTAA 2 cut(s) 240, 630
TscAI CASTG 1 cut(s) 252
TseFI GTSAC 2 cut(s) 141, 401
TseI GCWGC 2 cut(s) 40, 43
Tsp45I GTSAC 2 cut(s) 141, 401
TspDTI ATGAA 3 cut(s) 399, 446, 639
TspRI CASTG 1 cut(s) 252
VpaK11BI GGWCC 1 cut(s) 439
XapI RAATTY 3 cut(s) 539, 626, 666
XbaI TCTAGA 1 cut(s) 352
XspI CTAG 1 cut(s) 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.