Rh2AG103200

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0008378
Physical Location & Seq
Forward (+)
8863804 .. 8864879
1076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG103200.1

Sequence Viewer

Length: 504 bp
ATGAGCACTCAAATTGTTGCTCGTATTTTGGTTAAGGCACTGATGGCAATGCCCGCTCCCGATTTCAGCCTCTGTCTCTTCCTAATTCCAGAAAGAGTGCAAATGGAGGAGCAGTTCAAGACTCTAATTGTCCTATCTCACTATCTAGAGACAGGAAGATTCAGTCAATTCTGGGATGATGCATCTAAGAATCGTCACATACTTGAAGCTGTCCCAGGTTTTGAGCAAGCGGTCCAAGCCTATGCAGTTCATGTTCTTTCCTTGACTTACCAAAAGGTTCCCAGATCTGTGCTTGCTGAGGCAATCAACCTTGAAGGTATATCCTTGGACAAATTCCTTGAGCATCATGTGGCCAATAGCGGTTGGGTTCTTGAAAAAGGTCATGGCAAGGGCCAACTCATTGTCTTACCTCGAAATGAATTTAACCATCCCGAGCTGAAGAAAAGCACAGACGATGGAATTCCATTAGACCATGTGGCTCGAATCTTCCCCATCCTGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005852 GO:0032991 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CSN8_PSD8_EIF3K

Protein Analysis

167

Amino Acids

18.82

Weight (kDa)

6.22

Isoelectric Point (pI)

34.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CSN8_PSD8_EIF3K PF10075 3 - 127 8.6e-17 CSN8/PSMD8/EIF3K family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 56
AciI CCGC 3 cut(s) 54, 230, 360
AcoI YGGCCR 1 cut(s) 351
AcsI RAATTY 3 cut(s) 332, 419, 459
AcuI CTGAAG 1 cut(s) 458
AfiI CCNNNNNNNGG 2 cut(s) 496, 497
AgsI TTSAA 4 cut(s) 118, 206, 314, 374
AjnI CCWGG 2 cut(s) 214, 495
AloI GAACNNNNNNTCC 2 cut(s) 98, 130
AluBI AGCT 2 cut(s) 209, 436
AluI AGCT 2 cut(s) 209, 436
Alw21I GWGCWC 1 cut(s) 8
Alw26I GTCTC 2 cut(s) 80, 143
AlwNI CAGNNNCTG 1 cut(s) 72
Ama87I CYCGRG 1 cut(s) 431
AoxI GGCC 2 cut(s) 351, 391
ApoI RAATTY 3 cut(s) 332, 419, 459
AspS9I GGNCC 2 cut(s) 232, 391
AvaI CYCGRG 1 cut(s) 431
AvaII GGWCC 1 cut(s) 232
BalI TGGCCA 1 cut(s) 353
Bbv12I GWGCWC 1 cut(s) 8
BbvCI CCTCAGC 1 cut(s) 297
BccI CCATC 4 cut(s) 37, 435, 449, 500
BciT130I CCWGG 2 cut(s) 216, 497
BcoDI GTCTC 2 cut(s) 80, 143
BfaI CTAG 1 cut(s) 146
BglII AGATCT 1 cut(s) 284
Bme1390I CCNGG 2 cut(s) 216, 497
Bme18I GGWCC 1 cut(s) 232
BmeT110I CYCGRG 1 cut(s) 431
BmgT120I GGNCC 2 cut(s) 232, 391
BmiI GGNNCC 1 cut(s) 279
BmrFI CCNGG 2 cut(s) 216, 497
BmsI GCATC 3 cut(s) 169, 191, 352
Bpu10I CCTNAGC 1 cut(s) 297
BpuEI CTTGAG 1 cut(s) 359
BsaJI CCNNGG 3 cut(s) 214, 324, 496
BsaXI ACNNNNNCTCC 2 cut(s) 98, 128
Bsc4I CCNNNNNNNGG 2 cut(s) 496, 497
Bse3DI GCAATG 1 cut(s) 54
BseBI CCWGG 2 cut(s) 216, 497
BseDI CCNNGG 3 cut(s) 214, 324, 496
BseGI GGATG 3 cut(s) 181, 427, 492
BseLI CCNNNNNNNGG 2 cut(s) 496, 497
BseMI GCAATG 1 cut(s) 54
BseMII CTCAG 1 cut(s) 288
BseRI GAGGAG 1 cut(s) 122
BshFI GGCC 2 cut(s) 353, 393
BsiHKAI GWGCWC 1 cut(s) 8
BsiHKCI CYCGRG 1 cut(s) 431
BslFI GGGAC 1 cut(s) 197
BslI CCNNNNNNNGG 2 cut(s) 496, 497
BsmAI GTCTC 2 cut(s) 80, 143
BsmFI GGGAC 1 cut(s) 197
BsnI GGCC 2 cut(s) 353, 393
BsoBI CYCGRG 1 cut(s) 431
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 284
BspACI CCGC 3 cut(s) 54, 230, 360
BspANI GGCC 2 cut(s) 353, 393
BspCNI CTCAG 1 cut(s) 289
BspLI GGNNCC 1 cut(s) 279
BsrBI CCGCTC 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 54
BssECI CCNNGG 3 cut(s) 214, 324, 496
BssMI GATC 1 cut(s) 284
BssT1I CCWWGG 1 cut(s) 324
Bst2UI CCWGG 2 cut(s) 216, 497
Bst6I CTCTTC 1 cut(s) 83
BstC8I GCNNGC 3 cut(s) 54, 228, 294
BstDEI CTNAG 2 cut(s) 186, 297
BstF5I GGATG 3 cut(s) 181, 427, 492
BstKTI GATC 1 cut(s) 287
BstMAI GTCTC 2 cut(s) 80, 143
BstMBI GATC 1 cut(s) 284
BstMWI GCNNNNNNNGC 3 cut(s) 44, 53, 236
BstNI CCWGG 2 cut(s) 216, 497
BstSCI CCNGG 2 cut(s) 214, 495
BstX2I RGATCY 1 cut(s) 284
BstYI RGATCY 1 cut(s) 284
BsuRI GGCC 2 cut(s) 353, 393
BtsCI GGATG 3 cut(s) 181, 427, 492
BtsIMutI CAGTG 1 cut(s) 38
Cac8I GCNNGC 3 cut(s) 54, 228, 294
CaiI CAGNNNCTG 1 cut(s) 72
Cfr13I GGNCC 2 cut(s) 232, 391
CviAII CATG 4 cut(s) 251, 347, 383, 473
CviJI RGCY 7 cut(s) 69, 209, 239, 353, 393, 436, 479
CviKI_1 RGCY 7 cut(s) 69, 209, 239, 353, 393, 436, 479
DdeI CTNAG 2 cut(s) 186, 297
DpnI GATC 1 cut(s) 286
DpnII GATC 1 cut(s) 284
EaeI YGGCCR 1 cut(s) 351
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
Eco130I CCWWGG 1 cut(s) 324
Eco47I GGWCC 1 cut(s) 232
Eco57I CTGAAG 1 cut(s) 458
Eco88I CYCGRG 1 cut(s) 431
EcoRI GAATTC 1 cut(s) 459
EcoRII CCWGG 2 cut(s) 214, 495
EcoT14I CCWWGG 1 cut(s) 324
EcoT22I ATGCAT 1 cut(s) 184
ErhI CCWWGG 1 cut(s) 324
FaeI CATG 4 cut(s) 254, 350, 386, 476
FaiI YATR 7 cut(s) 200, 243, 252, 320, 348, 384, 474
FaqI GGGAC 1 cut(s) 197
FatI CATG 4 cut(s) 250, 346, 382, 472
FauI CCCGC 1 cut(s) 61
FokI GGATG 3 cut(s) 188, 414, 479
FspBI CTAG 1 cut(s) 146
HaeIII GGCC 2 cut(s) 353, 393
Hin1II CATG 4 cut(s) 254, 350, 386, 476
HinfI GANTC 4 cut(s) 121, 159, 190, 483
Hpy188III TCNNGA 6 cut(s) 59, 89, 118, 146, 371, 431
HpyAV CCTTC 1 cut(s) 308
HpyCH4V TGCA 3 cut(s) 100, 182, 245
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 53, 236
HpyF3I CTNAG 2 cut(s) 186, 297
Hsp92II CATG 4 cut(s) 254, 350, 386, 476
Kzo9I GATC 1 cut(s) 284
LmnI GCTCC 2 cut(s) 61, 109
LpnPI CCDG 7 cut(s) 102, 138, 157, 201, 228, 295, 482
LweI GCATC 3 cut(s) 169, 191, 352
MaeI CTAG 1 cut(s) 146
MaeIII GTNAC 1 cut(s) 194
MalI GATC 1 cut(s) 286
MbiI CCGCTC 1 cut(s) 56
MboI GATC 1 cut(s) 284
MboII GAAGA 4 cut(s) 70, 168, 451, 478
MflI RGATCY 1 cut(s) 284
MhlI GDGCHC 1 cut(s) 8
MlsI TGGCCA 1 cut(s) 353
MluCI AATT 7 cut(s) 12, 84, 126, 167, 332, 419, 459
MluNI TGGCCA 1 cut(s) 353
MlyI GAGTC 1 cut(s) 115
MnlI CCTC 4 cut(s) 80, 100, 292, 420
Mox20I TGGCCA 1 cut(s) 353
Mph1103I ATGCAT 1 cut(s) 184
MscI TGGCCA 1 cut(s) 353
MseI TTAA 2 cut(s) 33, 423
Msp20I TGGCCA 1 cut(s) 353
MspR9I CCNGG 2 cut(s) 216, 497
MvaI CCWGG 2 cut(s) 216, 497
MwoI GCNNNNNNNGC 3 cut(s) 44, 53, 236
NdeII GATC 1 cut(s) 284
NlaIII CATG 4 cut(s) 254, 350, 386, 476
NlaIV GGNNCC 1 cut(s) 279
NmuCI GTSAC 1 cut(s) 194
NsiI ATGCAT 1 cut(s) 184
PfeI GAWTC 3 cut(s) 159, 190, 483
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
Psp6I CCWGG 2 cut(s) 214, 495
PspGI CCWGG 2 cut(s) 214, 495
PspN4I GGNNCC 1 cut(s) 279
PspPI GGNCC 2 cut(s) 232, 391
PstNI CAGNNNCTG 1 cut(s) 72
PsuI RGATCY 1 cut(s) 284
SaqAI TTAA 2 cut(s) 33, 423
Sau3AI GATC 1 cut(s) 284
Sau96I GGNCC 2 cut(s) 232, 391
SchI GAGTC 1 cut(s) 115
ScrFI CCNGG 2 cut(s) 216, 497
SduI GDGCHC 1 cut(s) 8
SetI ASST 8 cut(s) 211, 220, 279, 312, 319, 382, 412, 438
SfaNI GCATC 3 cut(s) 169, 191, 352
SinI GGWCC 1 cut(s) 232
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 7 cut(s) 12, 84, 126, 167, 332, 419, 459
SsiI CCGC 3 cut(s) 54, 230, 360
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 2 cut(s) 214, 495
StyI CCWWGG 1 cut(s) 324
TaqI TCGA 2 cut(s) 412, 481
TasI AATT 7 cut(s) 12, 84, 126, 167, 332, 419, 459
TfiI GAWTC 3 cut(s) 159, 190, 483
Tru1I TTAA 2 cut(s) 33, 423
Tru9I TTAA 2 cut(s) 33, 423
TscAI CASTG 1 cut(s) 45
TseFI GTSAC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 194
TspDTI ATGAA 2 cut(s) 239, 432
TspRI CASTG 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 232
XapI RAATTY 3 cut(s) 332, 419, 459
XbaI TCTAGA 1 cut(s) 145
XspI CTAG 1 cut(s) 146
Zsp2I ATGCAT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.