Rh6AG047300

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
6890533 .. 6891088
556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG047300.1

Sequence Viewer

Length: 231 bp
ATGGTTTGTTCTTGTAATTTTTGGGTGTCATTTGAGCCAGAGCATATTGGCACTCAAATTGTTGCTTGTATTCTGGTCAAGGCATTGATGGCAATGCCTGCTCTCGATTTCAACCTTTGTCTCTTCCTAATTCCAGAAAAAGTGGTTACAGCAATTGGACTTTCAGGCTTTTATTCTGACAACAAAGGTTATCCTCACTTCATTGTTTACTTCATGAATCTTCTTTATTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.6

Weight (kDa)

5.38

Isoelectric Point (pI)

39.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 125
BccI CCATC 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 99
BseMI GCAATG 1 cut(s) 99
BsmAI GTCTC 1 cut(s) 125
BspHI TCATGA 1 cut(s) 213
BsrDI GCAATG 1 cut(s) 99
Bst6I CTCTTC 1 cut(s) 128
BstAPI GCANNNNNTGC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 99
BstMAI GTCTC 1 cut(s) 125
BstMWI GCNNNNNNNGC 2 cut(s) 89, 98
Cac8I GCNNGC 1 cut(s) 99
CciI TCATGA 1 cut(s) 213
CviAII CATG 1 cut(s) 214
CviJI RGCY 2 cut(s) 37, 168
CviKI_1 RGCY 2 cut(s) 37, 168
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
FaeI CATG 1 cut(s) 217
FaiI YATR 2 cut(s) 45, 215
FatI CATG 1 cut(s) 213
Hin1II CATG 1 cut(s) 217
HinfI GANTC 1 cut(s) 217
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 3 cut(s) 104, 134, 214
Hpy8I GTNNAC 1 cut(s) 208
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 98
Hsp92II CATG 1 cut(s) 217
LpnPI CCDG 5 cut(s) 51, 59, 111, 147, 150
MaeIII GTNAC 1 cut(s) 145
MboII GAAGA 2 cut(s) 115, 212
MfeI CAATTG 1 cut(s) 153
MluCI AATT 4 cut(s) 16, 57, 129, 153
MnlI CCTC 1 cut(s) 204
MunI CAATTG 1 cut(s) 153
MwoI GCNNNNNNNGC 2 cut(s) 89, 98
NlaIII CATG 1 cut(s) 217
PagI TCATGA 1 cut(s) 213
PfeI GAWTC 1 cut(s) 217
SetI ASST 2 cut(s) 117, 190
Sse9I AATT 4 cut(s) 16, 57, 129, 153
TaqI TCGA 1 cut(s) 105
TasI AATT 4 cut(s) 16, 57, 129, 153
TfiI GAWTC 1 cut(s) 217
TspDTI ATGAA 3 cut(s) 190, 202, 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.