Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7992028.1

Orthogroup ID

OG0004100

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 377

Gene Structure 376 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7992028.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 376 bp

atgaaaatcaaagaaagaacagttgtttgggtggccaacagagacaatccgctcccaaacaactcagccagtctcaaaatcggatacgacggaatactttctcttgtggatgaatccggaaaagtttcttggatgtcaagcaatcaatcacaatttgttaaaaatccaatccttcagcttttggattccggcaacttggtcctcaaagaagcaaatgaaaccaaccctaacaagttcctctggcagagcttcgactaccctacacacactttgttgccggagatgaagctcggaaggaactcgaataccggattggatagatacataacctcgtggaaaactccacaagacccttctactggtgattattccttca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin DUF3403 PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

125

Amino Acids

14.15

Weight (kDa)

6.56

Isoelectric Point (pI)

35.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004100)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G65790 AT1G65790 AT1G65790 AT1G65800 AT1G65800 AT4G21380 AT4G21380 AT5G39370
fragaria_vesca	FvH4_3g03430
malus_domestica	MD02G1167300.v1.1 MD03G1187400.v1.1
prunus_persica	Prupe.4G032300_v2.0.a1 Prupe.4G237700_v2.0.a1 Prupe.4G251300_v2.0.a1
pyrus_communis	pycom03g14020
rosa_chinensis	RchiOBHm_Chr5g0005211 RchiOBHm_Chr5g0074281
rosa_laevigata	RLG00000031300 RLG00000036463
rosa_multiflora	Rmu_co7992028.1_g000001 Rmu_sc0004706.1_g000005 Rmu_sc0014528.1_g000001 Rmu_sc0028767.1_g000001 Rmu_sc0028768.1_g000001
rosa_roxburghii	Rroxscaffold_1G00007200 Rroxscaffold_1G00070460
rosa_rugosa	Rorug04G0416100 Rorug05G0429800
rosa_samantha	Rh5AG487600 Rh5CG048800 Rh5CG531400 Rh5DG521200
rosa_wichuraiana	Rw5G045250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	52
AccIII	TCCGGA	1 cut(s)	116
AciI	CCGC	1 cut(s)	50
AcoI	YGGCCR	1 cut(s)	33
AcuI	CTGAAG	1 cut(s)	158
AfiI	CCNNNNNNNGG	1 cut(s)	359
AjuI	GAANNNNNNNTTGG	6 cut(s)	10, 42, 112, 144, 296, 328
AluBI	AGCT	3 cut(s)	178, 249, 289
AluI	AGCT	3 cut(s)	178, 249, 289
Alw26I	GTCTC	2 cut(s)	36, 77
Aor13HI	TCCGGA	1 cut(s)	116
AoxI	GGCC	1 cut(s)	33
Asp700I	GAANNNNTTC	2 cut(s)	97, 124
AspS9I	GGNCC	1 cut(s)	199
AsuHPI	GGTGA	1 cut(s)	374
AvaII	GGWCC	1 cut(s)	199
BalI	TGGCCA	1 cut(s)	35
BauI	CACGAG	1 cut(s)	331
BciVI	GTATCC	1 cut(s)	77
BcoDI	GTCTC	2 cut(s)	36, 77
BfuI	GTATCC	1 cut(s)	77
Bme18I	GGWCC	1 cut(s)	199
BmgT120I	GGNCC	1 cut(s)	199
BsaWI	WCCGGW	2 cut(s)	116, 308
Bsc4I	CCNNNNNNNGG	1 cut(s)	359
Bse1I	ACTGG	2 cut(s)	69, 364
BseAI	TCCGGA	1 cut(s)	116
BseGI	GGATG	2 cut(s)	115, 138
BseLI	CCNNNNNNNGG	1 cut(s)	359
BseMII	CTCAG	1 cut(s)	78
BseNI	ACTGG	2 cut(s)	69, 364
BshFI	GGCC	1 cut(s)	35
BsiSI	CCGG	4 cut(s)	117, 189, 278, 309
BslI	CCNNNNNNNGG	1 cut(s)	359
BsmAI	GTCTC	2 cut(s)	36, 77
BsnI	GGCC	1 cut(s)	35
Bsp13I	TCCGGA	1 cut(s)	116
BspACI	CCGC	1 cut(s)	50
BspANI	GGCC	1 cut(s)	35
BspCNI	CTCAG	1 cut(s)	77
BspEI	TCCGGA	1 cut(s)	116
BsrBI	CCGCTC	1 cut(s)	52
BsrI	ACTGG	2 cut(s)	69, 364
BssSI	CACGAG	1 cut(s)	331
Bst2BI	CACGAG	1 cut(s)	331
Bst4CI	ACNGT	1 cut(s)	22
BstDEI	CTNAG	1 cut(s)	64
BstF5I	GGATG	2 cut(s)	115, 138
BstMAI	GTCTC	2 cut(s)	36, 77
BsuI	GTATCC	1 cut(s)	77
BsuRI	GGCC	1 cut(s)	35
BtsCI	GGATG	2 cut(s)	115, 138
Cfr13I	GGNCC	1 cut(s)	199
CviJI	RGCY	5 cut(s)	35, 68, 178, 249, 289
CviKI_1	RGCY	5 cut(s)	35, 68, 178, 249, 289
DdeI	CTNAG	1 cut(s)	64
EaeI	YGGCCR	1 cut(s)	33
Eco47I	GGWCC	1 cut(s)	199
Eco57I	CTGAAG	1 cut(s)	158
FaiI	YATR	1 cut(s)	326
FokI	GGATG	2 cut(s)	122, 145
HaeIII	GGCC	1 cut(s)	35
HapII	CCGG	4 cut(s)	117, 189, 278, 309
HinfI	GANTC	2 cut(s)	113, 185
HpaII	CCGG	4 cut(s)	117, 189, 278, 309
HphI	GGTGA	1 cut(s)	374
Hpy188I	TCNGA	2 cut(s)	83, 293
Hpy188III	TCNNGA	1 cut(s)	117
Hpy99I	CGWCG	1 cut(s)	92
HpyAV	CCTTC	3 cut(s)	182, 288, 363
HpyCH4III	ACNGT	1 cut(s)	22
HpyF3I	CTNAG	1 cut(s)	64
Kpn2I	TCCGGA	1 cut(s)	116
LmnI	GCTCC	1 cut(s)	57
LpnPI	CCDG	7 cut(s)	82, 130, 202, 226, 291, 322, 345
MbiI	CCGCTC	1 cut(s)	52
MlsI	TGGCCA	1 cut(s)	35
MluCI	AATT	1 cut(s)	152
MluNI	TGGCCA	1 cut(s)	35
MnlI	CCTC	3 cut(s)	212, 248, 340
Mox20I	TGGCCA	1 cut(s)	35
MroI	TCCGGA	1 cut(s)	116
MroXI	GAANNNNTTC	2 cut(s)	97, 124
MscI	TGGCCA	1 cut(s)	35
MseI	TTAA	1 cut(s)	159
Msp20I	TGGCCA	1 cut(s)	35
MspI	CCGG	4 cut(s)	117, 189, 278, 309
PdmI	GAANNNNTTC	2 cut(s)	97, 124
PfeI	GAWTC	2 cut(s)	113, 185
PspPI	GGNCC	1 cut(s)	199
SaqAI	TTAA	1 cut(s)	159
Sau96I	GGNCC	1 cut(s)	199
SetI	ASST	4 cut(s)	180, 251, 291, 332
SinI	GGWCC	1 cut(s)	199
Sse9I	AATT	1 cut(s)	152
SsiI	CCGC	1 cut(s)	50
TaaI	ACNGT	1 cut(s)	22
TaqI	TCGA	2 cut(s)	252, 302
TasI	AATT	1 cut(s)	152
TfiI	GAWTC	2 cut(s)	113, 185
Tru1I	TTAA	1 cut(s)	159
Tru9I	TTAA	1 cut(s)	159
TspDTI	ATGAA	4 cut(s)	17, 126, 231, 299
TspGWI	ACGGA	1 cut(s)	105
VpaK11BI	GGWCC	1 cut(s)	199
XmnI	GAANNNNTTC	2 cut(s)	97, 124

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.