Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014528.1

Orthogroup ID

OG0004100

Physical Location & Seq

Genomic Coordinates Reverse (-)

259 .. 5479

Gene Structure 5221 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014528.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2550 bp

atgagagatttagcaaagccccattgcttttccaccgttattcttctcctcactttactctctttcttctccgttgccaaatccaaagacaccttgtctgcaactgaatctctcggaccaaaccagaccctcgtctccgccggtgaggttttcgaattgggtttcttcgagctaggcacagactcaagatggtacttgggcatatggtacaagaaaatcgaacaacgaactgttgtttgggaagccaacagaaacaacccgctcccaaacaactcatccagtctcaaaattggttacgatggaaaactttctcttgtggatgaattcggaaacgtttcttggtccagcaatcaatcacaatttgttggcgtctctaaaaatccaatcctgcagcttttggattccggcaatttggtcctcaaagaagcaaatgagatcaaccctaacaagtttctctggcagagcttcgactatcccacagacactttgttgccggagatgaagcttggatggaacttgaatactagtttggacagatacatatcgtcatggaaaactccagaagacccttctacaggagattactccttcaagctcgactaccacggtttcccggaggttttcctccggcagaaacagtccacaatataccggagcgggccctggaatggactgagatttagcggcgttccagagatgaacgccggtaatggtattggtttcaacttcgttgtaaatgatgaggaagtgtactactcgttttcggaacaagtcaatgaaactaatccagctctgaattcaaggctgatcgtaactccctcgggaaacctccaacggctgacgtggatcgagagcagcaagatctggaacaagtactggttcgctcccaaggaccaatgcgacagttacagcgagtgcgggccctatggtgtctgcgacgccaacgcttcgccagtgtgtaagtgcatgaaggggttccaacctaagaacccttcggcgtggagcttgagagacggctccgacgggtgtgagcgagagacggagctggagtgtgggaataaggacaagtttatgaaggtggagaatgtgaagctgccggagagcggcggagcggtggtggacatggagatgagtttggaggagtgtaaggtgaagtgtttggggaactgctcgtgtagtggttattcgagtgcgaggattcagaatggagggagtggatgtgtgatgtggtttgggaagttgatggatatgaggagttatgccgacggcgggcaagagttctatctccggttagcagcttctgaactagatggtgatgggaaaaaaaaaataattatgatcgtcggcattgtagttggtattgccgttctgctatcagctggtcttattatctgttttgtgcggaggaggaggaattcgggtagcactttaaataggagggaatcaaaaggtccgcttgaaagaagccaggattttctgctaaacagtgtggtagtctcaagtaagaaggatcactactctggtgacaggagcaatgatgacctagagttgcctttgtttgatttcagctctgtagtagcggctacggacaacttttctgatgaaaataaactgggacaaggaggtttcggttgtgtttacaaggggttggtcgagggtcaagagatcgctgtgaagagactttcaaaaaactctggacaaggaactgaagaattcaaaaacgaagtaaagttaattgcaaggcttcaacacagaaatcttgttcgattgctcggttgctgcgttgatgtggatgaaaagatgctgatttacgaatacatggaaaataaaagcctcgattcttttttattcgataaagcgaaaaggtatttgctggattggcaaaagcgtttcaacattatatgtgggattgctcgaggacttctttatcttcatcaggattcgagattcaggatcatccatagggacctcaaggcaagcaacattctacttgatggagaattggaccccaagatatcggactttggaatggcaagaatatttggtcaggatcagacagaagccaatacaaaaaaagtagtgggaacatatggctatatgtctcctgaatacgcaatggatggcctcttctcaatcaagtcagatgtatttagttttggtgttctagtgttggagattgttagtggtcaaaagaacagaggattttattattccaacaatgagctaaacctcctaggacatgcttgggagttatggaatgaaggtcgtgcattggatataatagattcttcagttggtgcttcattttcggaatctgaggtgttgagatgcatgcaggttgggcttttatgcgtccaagagcgtgcagaagataggcctacaatgtccactgtggttctgatgttaagtagtgaaaatgcaccactaccacagcctaaaaaccccggtttttgcctaggaaggaaaccagaaacagagtcatcctcaagcaagcaagacgagtcattcactgtaaaccaagtaactgtcacaatattagatcctaggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin DUF3403 PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

849

Amino Acids

95.08

Weight (kDa)

5.42

Isoelectric Point (pI)

45.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004100)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G65790 AT1G65790 AT1G65790 AT1G65800 AT1G65800 AT4G21380 AT4G21380 AT5G39370
fragaria_vesca	FvH4_3g03430
malus_domestica	MD02G1167300.v1.1 MD03G1187400.v1.1
prunus_persica	Prupe.4G032300_v2.0.a1 Prupe.4G237700_v2.0.a1 Prupe.4G251300_v2.0.a1
pyrus_communis	pycom03g14020
rosa_chinensis	RchiOBHm_Chr5g0005211 RchiOBHm_Chr5g0074281
rosa_laevigata	RLG00000031300 RLG00000036463
rosa_multiflora	Rmu_co7992028.1_g000001 Rmu_sc0004706.1_g000005 Rmu_sc0014528.1_g000001 Rmu_sc0028767.1_g000001 Rmu_sc0028768.1_g000001
rosa_roxburghii	Rroxscaffold_1G00007200 Rroxscaffold_1G00070460
rosa_rugosa	Rorug04G0416100 Rorug05G0429800
rosa_samantha	Rh5AG487600 Rh5CG048800 Rh5CG531400 Rh5DG521200
rosa_wichuraiana	Rw5G045250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	2326
AccBSI	CCGCTC	4 cut(s)	262, 657, 1104, 1112
AclI	AACGTT	1 cut(s)	333
AclWI	GGATC	5 cut(s)	854, 1518, 1961, 2058, 2534
AcsI	RAATTY	4 cut(s)	323, 796, 1414, 1712
AcuI	CTGAAG	2 cut(s)	1728, 2274
AcyI	GRCGYC	2 cut(s)	369, 939
AfaI	GTAC	4 cut(s)	194, 209, 752, 875
AfiI	CCNNNNNNNGG	4 cut(s)	575, 668, 1103, 1269
AgsI	TTSAA	9 cut(s)	520, 592, 724, 801, 1460, 1686, 1717, 1748, 1894
AhdI	GACNNNNNGTC	1 cut(s)	94
AhlI	ACTAGT	1 cut(s)	524
AjiI	CACGTC	1 cut(s)	843
AjnI	CCWGG	2 cut(s)	662, 1467
AjuI	GAANNNNNNNTTGG	6 cut(s)	220, 252, 322, 354, 512, 544
Alw26I	GTCTC	8 cut(s)	139, 287, 376, 1005, 1031, 1501, 1672, 2106
AlwI	GGATC	5 cut(s)	854, 1518, 1961, 2058, 2534
AlwNI	CAGNNNCTG	1 cut(s)	1301
Ama87I	CYCGRG	2 cut(s)	820, 1914
AoxI	GGCC	4 cut(s)	659, 920, 2122, 2375
ApaI	GGGCCC	2 cut(s)	663, 924
ApeKI	GCWGC	5 cut(s)	391, 855, 1093, 1295, 1779
ApoI	RAATTY	4 cut(s)	323, 796, 1414, 1712
Asp700I	GAANNNNTTC	3 cut(s)	307, 334, 974
AspA2I	CCTAGG	3 cut(s)	2233, 2455, 2543
AsuC2I	CCSGG	2 cut(s)	614, 2445
AsuHPI	GGTGA	4 cut(s)	155, 1162, 1325, 1535
AsuII	TTCGAA	1 cut(s)	153
AvaI	CYCGRG	2 cut(s)	820, 1914
AvaII	GGWCC	7 cut(s)	116, 342, 415, 892, 1451, 1966, 2005
AvrII	CCTAGG	3 cut(s)	2233, 2455, 2543
BaeGI	GKGCMC	2 cut(s)	663, 924
BanII	GRGCYC	2 cut(s)	663, 924
BarI	GAAGNNNNNNTAC	2 cut(s)	1499, 1531
BauI	CACGAG	1 cut(s)	1171
BbsI	GAAGAC	1 cut(s)	570
BbvI	GCAGC	5 cut(s)	403, 867, 1080, 1307, 1766
BccI	CCATC	8 cut(s)	183, 293, 504, 1237, 1304, 1310, 1988, 2114
BceAI	ACGGC	4 cut(s)	851, 1030, 1282, 1349
BciT130I	CCWGG	2 cut(s)	664, 1469
BcnI	CCSGG	2 cut(s)	614, 2445
BcoDI	GTCTC	8 cut(s)	139, 287, 376, 1005, 1031, 1501, 1672, 2106
BcuI	ACTAGT	1 cut(s)	524
BfaI	CTAG	8 cut(s)	173, 525, 1307, 1544, 2165, 2234, 2456, 2544
BfmI	CTRYAG	3 cut(s)	389, 573, 1572
BfuAI	ACCTGC	1 cut(s)	2326
BglII	AGATCT	1 cut(s)	861
BisI	GCNGC	8 cut(s)	392, 685, 856, 1094, 1105, 1296, 1581, 1780
BlnI	CCTAGG	3 cut(s)	2233, 2455, 2543
BlsI	GCNGC	8 cut(s)	393, 686, 857, 1095, 1106, 1297, 1582, 1781
BmcAI	AGTACT	1 cut(s)	875
Bme1390I	CCNGG	4 cut(s)	614, 664, 1469, 2445
Bme18I	GGWCC	7 cut(s)	116, 342, 415, 892, 1451, 1966, 2005
BmeRI	GACNNNNNGTC	1 cut(s)	94
BmeT110I	CYCGRG	2 cut(s)	820, 1914
BmgBI	CACGTC	1 cut(s)	843
BmiI	GGNNCC	6 cut(s)	661, 922, 977, 1018, 1967, 2007
BmrFI	CCNGG	4 cut(s)	614, 664, 1469, 2445
BmrI	ACTGGG	1 cut(s)	1622
BmsI	GCATC	2 cut(s)	1791, 2318
BmuI	ACTGGG	1 cut(s)	1622
BoxI	GACNNNNGTC	1 cut(s)	131
BpiI	GAAGAC	1 cut(s)	570
BplI	GAGNNNNNCTC	2 cut(s)	2468, 2500
BpmI	CTGGAG	2 cut(s)	543, 1067
Bpu14I	TTCGAA	1 cut(s)	153
BpuEI	CTTGAG	5 cut(s)	169, 1027, 1483, 1955, 2470
BpuMI	CCSGG	2 cut(s)	614, 2445
BsaBI	GATNNNNATC	1 cut(s)	541
BsaHI	GRCGYC	2 cut(s)	369, 939
BsaJI	CCNNGG	8 cut(s)	604, 662, 819, 888, 2233, 2443, 2455, 2543
BsaWI	WCCGGW	2 cut(s)	651, 1287
BsaXI	ACNNNNNCTCC	6 cut(s)	1034, 1064, 1101, 1131, 1204, 1234
Bsc4I	CCNNNNNNNGG	4 cut(s)	575, 668, 1103, 1269
Bse118I	RCCGGY	2 cut(s)	140, 704
Bse1I	ACTGG	4 cut(s)	279, 881, 953, 1617
Bse3DI	GCAATG	3 cut(s)	22, 1540, 2121
Bse8I	GATNNNNATC	1 cut(s)	541
BseBI	CCWGG	2 cut(s)	664, 1469
BseDI	CCNNGG	8 cut(s)	604, 662, 819, 888, 2233, 2443, 2455, 2543
BseGI	GGATG	8 cut(s)	275, 325, 515, 1223, 1798, 1956, 2125, 2480
BseJI	GATNNNNATC	1 cut(s)	541
BseLI	CCNNNNNNNGG	4 cut(s)	575, 668, 1103, 1269
BseMI	GCAATG	3 cut(s)	22, 1540, 2121
BseMII	CTCAG	2 cut(s)	665, 2307
BseNI	ACTGG	4 cut(s)	279, 881, 953, 1617
BseRI	GAGGAG	5 cut(s)	38, 1154, 1267, 1420, 1423
BseSI	GKGCMC	2 cut(s)	663, 924
BseXI	GCAGC	5 cut(s)	403, 867, 1080, 1307, 1766
BsgI	GTGCAG	1 cut(s)	2385
BshFI	GGCC	4 cut(s)	661, 922, 2124, 2377
BsiHKCI	CYCGRG	2 cut(s)	820, 1914
BslFI	GGGAC	2 cut(s)	1629, 1979
BslI	CCNNNNNNNGG	4 cut(s)	575, 668, 1103, 1269
BsmAI	GTCTC	8 cut(s)	139, 287, 376, 1005, 1031, 1501, 1672, 2106
BsmBI	CGTCTC	4 cut(s)	139, 376, 1005, 1031
BsmFI	GGGAC	2 cut(s)	1629, 1979
BsnI	GGCC	4 cut(s)	661, 922, 2124, 2377
BsoBI	CYCGRG	2 cut(s)	820, 1914
Bsp119I	TTCGAA	1 cut(s)	153
Bsp120I	GGGCCC	2 cut(s)	659, 920
Bsp1286I	GDGCHC	2 cut(s)	663, 924
BspANI	GGCC	4 cut(s)	661, 922, 2124, 2377
BspCNI	CTCAG	2 cut(s)	666, 2308
BspLI	GGNNCC	6 cut(s)	661, 922, 977, 1018, 1967, 2007
BspMAI	CTGCAG	1 cut(s)	393
BspMI	ACCTGC	1 cut(s)	2326
BspPI	GGATC	5 cut(s)	854, 1518, 1961, 2058, 2534
BspT104I	TTCGAA	1 cut(s)	153
BsrBI	CCGCTC	4 cut(s)	262, 657, 1104, 1112
BsrDI	GCAATG	3 cut(s)	22, 1540, 2121
BsrFI	RCCGGY	2 cut(s)	140, 704
BsrI	ACTGG	4 cut(s)	279, 881, 953, 1617
BssAI	RCCGGY	2 cut(s)	140, 704
BssECI	CCNNGG	8 cut(s)	604, 662, 819, 888, 2233, 2443, 2455, 2543
BssNI	GRCGYC	2 cut(s)	369, 939
BssSI	CACGAG	1 cut(s)	1171
BssT1I	CCWWGG	4 cut(s)	888, 2233, 2455, 2543
Bst2BI	CACGAG	1 cut(s)	1171
Bst2UI	CCWGG	2 cut(s)	664, 1469
Bst4CI	ACNGT	9 cut(s)	37, 232, 608, 639, 905, 1487, 2392, 2512, 2527
Bst6I	CTCTTC	2 cut(s)	1670, 2132
BstACI	GRCGYC	2 cut(s)	369, 939
BstBI	TTCGAA	1 cut(s)	153
BstC8I	GCNNGC	7 cut(s)	659, 920, 1271, 1978, 2333, 2364, 2492
BstDEI	CTNAG	3 cut(s)	674, 984, 2316
BstDSI	CCRYGG	1 cut(s)	604
BstENI	CCTNNNNNAGG	1 cut(s)	573
BstF5I	GGATG	8 cut(s)	275, 325, 515, 1223, 1798, 1956, 2125, 2480
BstMAI	GTCTC	8 cut(s)	139, 287, 376, 1005, 1031, 1501, 1672, 2106
BstMWI	GCNNNNNNNGC	2 cut(s)	1879, 2341
BstNI	CCWGG	2 cut(s)	664, 1469
BstNSI	RCATGY	2 cut(s)	2243, 2335
BstPAI	GACNNNNGTC	1 cut(s)	131
BstSCI	CCNGG	4 cut(s)	612, 662, 1467, 2443
BstSFI	CTRYAG	3 cut(s)	389, 573, 1572
BstSLI	GKGCMC	2 cut(s)	663, 924
BstV1I	GCAGC	5 cut(s)	403, 867, 1080, 1307, 1766
BstV2I	GAAGAC	1 cut(s)	570
BstX2I	RGATCY	2 cut(s)	861, 2539
BstYI	RGATCY	2 cut(s)	861, 2539
BsuRI	GGCC	4 cut(s)	661, 922, 2124, 2377
BtgI	CCRYGG	1 cut(s)	604
BtrI	CACGTC	1 cut(s)	843
BtsCI	GGATG	8 cut(s)	275, 325, 515, 1223, 1798, 1956, 2125, 2480
BtsIMutI	CAGTG	4 cut(s)	960, 1492, 2388, 2508
BveI	ACCTGC	1 cut(s)	2326
Cac8I	GCNNGC	7 cut(s)	659, 920, 1271, 1978, 2333, 2364, 2492
CaiI	CAGNNNCTG	1 cut(s)	1301
Cfr10I	RCCGGY	2 cut(s)	140, 704
CseI	GACGC	3 cut(s)	358, 947, 2341
Csp6I	GTAC	4 cut(s)	193, 208, 751, 874
CviAII	CATG	6 cut(s)	549, 967, 1123, 1819, 2240, 2332
CviQI	GTAC	4 cut(s)	193, 208, 751, 874
DdeI	CTNAG	3 cut(s)	674, 984, 2316
DraI	TTTAAA	1 cut(s)	1431
DriI	GACNNNNNGTC	1 cut(s)	94
Eam1104I	CTCTTC	2 cut(s)	1670, 2132
Eam1105I	GACNNNNNGTC	1 cut(s)	94
EarI	CTCTTC	2 cut(s)	1670, 2132
EciI	GGCGGA	2 cut(s)	127, 1122
Eco130I	CCWWGG	4 cut(s)	888, 2233, 2455, 2543
Eco147I	AGGCCT	1 cut(s)	2377
Eco24I	GRGCYC	2 cut(s)	663, 924
Eco32I	GATATC	1 cut(s)	2016
Eco47I	GGWCC	7 cut(s)	116, 342, 415, 892, 1451, 1966, 2005
Eco57I	CTGAAG	2 cut(s)	1728, 2274
Eco88I	CYCGRG	2 cut(s)	820, 1914
EcoNI	CCTNNNNNAGG	1 cut(s)	573
EcoO109I	RGGNCCY	3 cut(s)	660, 921, 1966
EcoRI	GAATTC	4 cut(s)	323, 796, 1414, 1712
EcoRII	CCWGG	2 cut(s)	662, 1467
EcoRV	GATATC	1 cut(s)	2016
EcoT14I	CCWWGG	4 cut(s)	888, 2233, 2455, 2543
EcoT22I	ATGCAT	1 cut(s)	2333
EcoT38I	GRGCYC	2 cut(s)	663, 924
ErhI	CCWWGG	4 cut(s)	888, 2233, 2455, 2543
Esp3I	CGTCTC	4 cut(s)	139, 376, 1005, 1031
FaeI	CATG	6 cut(s)	552, 970, 1126, 1822, 2243, 2335
FalI	AAGNNNNNCTT	2 cut(s)	1440, 1472
FaqI	GGGAC	2 cut(s)	1629, 1979
FatI	CATG	6 cut(s)	548, 966, 1122, 1818, 2239, 2331
FauI	CCCGC	4 cut(s)	267, 650, 911, 1262
FauNDI	CATATG	2 cut(s)	203, 2089
Fnu4HI	GCNGC	8 cut(s)	392, 685, 856, 1094, 1105, 1296, 1581, 1780
FokI	GGATG	8 cut(s)	262, 332, 522, 1230, 1805, 1943, 2132, 2467
FriOI	GRGCYC	2 cut(s)	663, 924
Fsp4HI	GCNGC	8 cut(s)	392, 685, 856, 1094, 1105, 1296, 1581, 1780
FspBI	CTAG	8 cut(s)	173, 525, 1307, 1544, 2165, 2234, 2456, 2544
GluI	GCNGC	8 cut(s)	392, 685, 856, 1094, 1105, 1296, 1581, 1780
GsuI	CTGGAG	2 cut(s)	543, 1067
HaeIII	GGCC	4 cut(s)	661, 922, 2124, 2377
HgaI	GACGC	3 cut(s)	358, 947, 2341
Hin1I	GRCGYC	2 cut(s)	369, 939
Hin1II	CATG	6 cut(s)	552, 970, 1126, 1822, 2243, 2335
HindIII	AAGCTT	1 cut(s)	503
HphI	GGTGA	4 cut(s)	155, 1162, 1325, 1535
Hpy166II	GTNNAC	6 cut(s)	642, 751, 1120, 1639, 2388, 2515
Hpy8I	GTNNAC	6 cut(s)	642, 751, 1120, 1639, 2388, 2515
Hpy99I	CGWCG	4 cut(s)	941, 1025, 1268, 1346
HpyAV	CCTTC	8 cut(s)	579, 598, 964, 1002, 1069, 1501, 2255, 2454
HpyCH4III	ACNGT	9 cut(s)	37, 232, 608, 639, 905, 1487, 2392, 2512, 2527
HpyCH4IV	ACGT	2 cut(s)	333, 842
HpyCH4V	TGCA	9 cut(s)	101, 391, 966, 1739, 2270, 2331, 2335, 2366, 2420
HpyF10VI	GCNNNNNNNGC	2 cut(s)	1879, 2341
HpyF3I	CTNAG	3 cut(s)	674, 984, 2316
HpySE526I	ACGT	2 cut(s)	333, 842
Hsp92I	GRCGYC	2 cut(s)	369, 939
Hsp92II	CATG	6 cut(s)	552, 970, 1126, 1822, 2243, 2335
LmnI	GCTCC	8 cut(s)	267, 654, 889, 1002, 1022, 1042, 1109, 1530
Lsp1109I	GCAGC	5 cut(s)	403, 867, 1080, 1307, 1766
LweI	GCATC	2 cut(s)	1791, 2318
MaeI	CTAG	8 cut(s)	173, 525, 1307, 1544, 2165, 2234, 2456, 2544
MaeII	ACGT	2 cut(s)	333, 842
MaeIII	GTNAC	6 cut(s)	293, 811, 905, 1523, 2521, 2527
MbiI	CCGCTC	4 cut(s)	262, 657, 1104, 1112
MflI	RGATCY	2 cut(s)	861, 2539
MhlI	GDGCHC	2 cut(s)	663, 924
MlyI	GAGTC	3 cut(s)	176, 2486, 2510
MmeI	TCCRAC	5 cut(s)	856, 1003, 1044, 2151, 2238
Mph1103I	ATGCAT	1 cut(s)	2333
MroXI	GAANNNNTTC	3 cut(s)	307, 334, 974
MseI	TTAA	3 cut(s)	1430, 1733, 2405
MslI	CAYNNNNRTG	1 cut(s)	1127
MspA1I	CMGCKG	1 cut(s)	1379
MspR9I	CCNGG	4 cut(s)	614, 664, 1469, 2445
MvaI	CCWGG	2 cut(s)	664, 1469
MwoI	GCNNNNNNNGC	2 cut(s)	1879, 2341
NciI	CCSGG	2 cut(s)	614, 2445
NdeI	CATATG	2 cut(s)	203, 2089
NlaIII	CATG	6 cut(s)	552, 970, 1126, 1822, 2243, 2335
NlaIV	GGNNCC	6 cut(s)	661, 922, 977, 1018, 1967, 2007
NmuCI	GTSAC	2 cut(s)	1523, 2527
NsiI	ATGCAT	1 cut(s)	2333
NspI	RCATGY	2 cut(s)	2243, 2335
NspV	TTCGAA	1 cut(s)	153
PaeI	GCATGC	1 cut(s)	2335
PaeR7I	CTCGAG	1 cut(s)	1914
PceI	AGGCCT	1 cut(s)	2377
PcsI	WCGNNNNNNNCGW	1 cut(s)	1779
PdmI	GAANNNNTTC	3 cut(s)	307, 334, 974
PfeI	GAWTC	9 cut(s)	107, 401, 1198, 1442, 1838, 1940, 1947, 2285, 2312
PfoI	TCCNGGA	1 cut(s)	612
PkrI	GCNGC	8 cut(s)	393, 686, 857, 1095, 1106, 1297, 1582, 1781
PleI	GAGTC	3 cut(s)	176, 2485, 2509
PpsI	GAGTC	3 cut(s)	176, 2485, 2509
PpuMI	RGGWCCY	1 cut(s)	1966
PshAI	GACNNNNGTC	1 cut(s)	131
Psp1406I	AACGTT	1 cut(s)	333
Psp5II	RGGWCCY	1 cut(s)	1966
Psp6I	CCWGG	2 cut(s)	662, 1467
PspGI	CCWGG	2 cut(s)	662, 1467
PspN4I	GGNNCC	6 cut(s)	661, 922, 977, 1018, 1967, 2007
PspOMI	GGGCCC	2 cut(s)	659, 920
PspPPI	RGGWCCY	1 cut(s)	1966
PspXI	VCTCGAGB	1 cut(s)	1914
PstI	CTGCAG	1 cut(s)	393
PstNI	CAGNNNCTG	1 cut(s)	1301
PsuI	RGATCY	2 cut(s)	861, 2539
PvuII	CAGCTG	1 cut(s)	1379
RsaI	GTAC	4 cut(s)	194, 209, 752, 875
RsaNI	GTAC	4 cut(s)	193, 208, 751, 874
RseI	CAYNNNNRTG	1 cut(s)	1127
SaqAI	TTAA	3 cut(s)	1430, 1733, 2405
SatI	GCNGC	8 cut(s)	392, 685, 856, 1094, 1105, 1296, 1581, 1780
ScaI	AGTACT	1 cut(s)	875
SchI	GAGTC	3 cut(s)	176, 2486, 2510
ScrFI	CCNGG	4 cut(s)	614, 664, 1469, 2445
SduI	GDGCHC	2 cut(s)	663, 924
SfaNI	GCATC	2 cut(s)	1791, 2318
SfcI	CTRYAG	3 cut(s)	389, 573, 1572
Sfr274I	CTCGAG	1 cut(s)	1914
SfuI	TTCGAA	1 cut(s)	153
SgrAI	CRCCGGYG	1 cut(s)	140
SinI	GGWCC	7 cut(s)	116, 342, 415, 892, 1451, 1966, 2005
SlaI	CTCGAG	1 cut(s)	1914
SmiMI	CAYNNNNRTG	1 cut(s)	1127
SmlI	CTYRAG	6 cut(s)	184, 1006, 1498, 1914, 1970, 2485
SmoI	CTYRAG	6 cut(s)	184, 1006, 1498, 1914, 1970, 2485
SpeI	ACTAGT	1 cut(s)	524
SphI	GCATGC	1 cut(s)	2335
SseBI	AGGCCT	1 cut(s)	2377
SspI	AATATT	2 cut(s)	2040, 2535
SspMI	CTAG	8 cut(s)	173, 525, 1307, 1544, 2165, 2234, 2456, 2544
StuI	AGGCCT	1 cut(s)	2377
StyD4I	CCNGG	4 cut(s)	612, 662, 1467, 2443
StyI	CCWWGG	4 cut(s)	888, 2233, 2455, 2543
TaaI	ACNGT	9 cut(s)	37, 232, 608, 639, 905, 1487, 2392, 2512, 2527
TaiI	ACGT	2 cut(s)	336, 845
TatI	WGTACW	2 cut(s)	750, 873
TauI	GCSGC	3 cut(s)	687, 1107, 1583
TfiI	GAWTC	9 cut(s)	107, 401, 1198, 1442, 1838, 1940, 1947, 2285, 2312
Tru1I	TTAA	3 cut(s)	1430, 1733, 2405
Tru9I	TTAA	3 cut(s)	1430, 1733, 2405
TscAI	CASTG	4 cut(s)	960, 1492, 2395, 2515
TseFI	GTSAC	2 cut(s)	1523, 2527
TseI	GCWGC	5 cut(s)	391, 855, 1093, 1295, 1779
Tsp45I	GTSAC	2 cut(s)	1523, 2527
TspGWI	ACGGA	3 cut(s)	61, 1055, 1601
TspRI	CASTG	4 cut(s)	960, 1492, 2395, 2515
VpaK11BI	GGWCC	7 cut(s)	116, 342, 415, 892, 1451, 1966, 2005
XagI	CCTNNNNNAGG	1 cut(s)	573
XapI	RAATTY	4 cut(s)	323, 796, 1414, 1712
XceI	RCATGY	2 cut(s)	2243, 2335
XhoI	CTCGAG	1 cut(s)	1914
XmaJI	CCTAGG	3 cut(s)	2233, 2455, 2543
XmnI	GAANNNNTTC	3 cut(s)	307, 334, 974
XspI	CTAG	8 cut(s)	173, 525, 1307, 1544, 2165, 2234, 2456, 2544
ZrmI	AGTACT	1 cut(s)	875
Zsp2I	ATGCAT	1 cut(s)	2333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.