Rmu_co8043290.1_g000001

Kinetochore protein Nuf2

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8043290.1
Physical Location & Seq
Reverse (-)
1 .. 219
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8043290.1_g000001.1.cds

Sequence Viewer

Length: 164 bp
atgtcgaagctggtatacccaaagctcagtcgcaccgagatcgtcacaatcctcgtcgaggctcagatcatcgctatttccgagcaggatcttctcaacccgaacccggatctcatcgccgacctctacacccgggtcctcaccaccttcgacttcctccccga

Protein Analysis

54

Amino Acids

6.13

Weight (kDa)

4.39

Isoelectric Point (pI)

38.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 15
AclWI GGATC 2 cut(s) 96, 117
AfiI CCNNNNNNNGG 2 cut(s) 58, 106
AluBI AGCT 2 cut(s) 10, 25
AluI AGCT 2 cut(s) 10, 25
AlwI GGATC 2 cut(s) 96, 117
Ama87I CYCGRG 1 cut(s) 132
AspS9I GGNCC 1 cut(s) 136
AsuC2I CCSGG 3 cut(s) 107, 133, 134
AsuHPI GGTGA 1 cut(s) 133
AvaI CYCGRG 1 cut(s) 132
AvaII GGWCC 1 cut(s) 136
BarI GAAGNNNNNNTAC 1 cut(s) 31
BcgI CGANNNNNNTGC 2 cut(s) 22, 56
BcnI CCSGG 3 cut(s) 107, 133, 134
Bme1390I CCNGG 3 cut(s) 107, 133, 134
Bme18I GGWCC 1 cut(s) 136
BmeT110I CYCGRG 1 cut(s) 132
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 137
BmrFI CCNGG 3 cut(s) 107, 133, 134
BpuMI CCSGG 3 cut(s) 107, 133, 134
BsaJI CCNNGG 1 cut(s) 132
Bsc4I CCNNNNNNNGG 2 cut(s) 58, 106
BseDI CCNNGG 1 cut(s) 132
BseLI CCNNNNNNNGG 2 cut(s) 58, 106
BseMII CTCAG 2 cut(s) 40, 77
BsiHKCI CYCGRG 1 cut(s) 132
BsiSI CCGG 2 cut(s) 107, 133
BslI CCNNNNNNNGG 2 cut(s) 58, 106
BsoBI CYCGRG 1 cut(s) 132
Bsp143I GATC 4 cut(s) 39, 66, 88, 109
BspCNI CTCAG 2 cut(s) 39, 76
BspLI GGNNCC 1 cut(s) 137
BspPI GGATC 2 cut(s) 96, 117
BssECI CCNNGG 1 cut(s) 132
BssMI GATC 4 cut(s) 39, 66, 88, 109
BssNAI GTATAC 1 cut(s) 16
Bst1107I GTATAC 1 cut(s) 16
BstDEI CTNAG 2 cut(s) 26, 63
BstENI CCTNNNNNAGG 1 cut(s) 56
BstKTI GATC 4 cut(s) 42, 69, 91, 112
BstMBI GATC 4 cut(s) 39, 66, 88, 109
BstSCI CCNGG 3 cut(s) 105, 131, 132
BstX2I RGATCY 2 cut(s) 88, 109
BstYI RGATCY 2 cut(s) 88, 109
BstZ17I GTATAC 1 cut(s) 16
BtgZI GCGATG 2 cut(s) 55, 100
Cfr13I GGNCC 1 cut(s) 136
Cfr9I CCCGGG 1 cut(s) 132
CviJI RGCY 3 cut(s) 10, 25, 62
CviKI_1 RGCY 3 cut(s) 10, 25, 62
DdeI CTNAG 2 cut(s) 26, 63
DpnI GATC 4 cut(s) 41, 68, 90, 111
DpnII GATC 4 cut(s) 39, 66, 88, 109
Eco47I GGWCC 1 cut(s) 136
Eco88I CYCGRG 1 cut(s) 132
EcoNI CCTNNNNNAGG 1 cut(s) 56
EcoO109I RGGNCCY 1 cut(s) 136
FaiI YATR 1 cut(s) 16
FblI GTMKAC 1 cut(s) 15
HapII CCGG 2 cut(s) 107, 133
HpaII CCGG 2 cut(s) 107, 133
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 66, 82
Hpy8I GTNNAC 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 59
HpyAV CCTTC 1 cut(s) 157
HpyF3I CTNAG 2 cut(s) 26, 63
Kzo9I GATC 4 cut(s) 39, 66, 88, 109
LpnPI CCDG 3 cut(s) 71, 120, 146
MaeIII GTNAC 1 cut(s) 43
MalI GATC 4 cut(s) 41, 68, 90, 111
MboI GATC 4 cut(s) 39, 66, 88, 109
MboII GAAGA 1 cut(s) 83
MflI RGATCY 2 cut(s) 88, 109
MnlI CCTC 4 cut(s) 52, 62, 134, 149
MspI CCGG 2 cut(s) 107, 133
MspR9I CCNGG 3 cut(s) 107, 133, 134
NciI CCSGG 3 cut(s) 107, 133, 134
NdeII GATC 4 cut(s) 39, 66, 88, 109
NlaIV GGNNCC 1 cut(s) 137
NmuCI GTSAC 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 78
PpuMI RGGWCCY 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 136
PspN4I GGNNCC 1 cut(s) 137
PspPI GGNCC 1 cut(s) 136
PspPPI RGGWCCY 1 cut(s) 136
PsuI RGATCY 2 cut(s) 88, 109
Sau3AI GATC 4 cut(s) 39, 66, 88, 109
Sau96I GGNCC 1 cut(s) 136
ScrFI CCNGG 3 cut(s) 107, 133, 134
SetI ASST 4 cut(s) 12, 27, 126, 149
SinI GGWCC 1 cut(s) 136
SmaI CCCGGG 1 cut(s) 134
StyD4I CCNGG 3 cut(s) 105, 131, 132
TaqI TCGA 3 cut(s) 5, 57, 150
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspMI CCCGGG 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 136
XagI CCTNNNNNAGG 1 cut(s) 56
XmaI CCCGGG 1 cut(s) 132
XmiI GTMKAC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.