Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8088552.1

Orthogroup ID

OG0004836

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 568

Gene Structure 568 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8088552.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

aaattacaaggagcctttgcaaaagaatgtgtttgtgctagaggtgttcgtattgttaacctacagaattcggctgggagaatttggcctgctacgttcactgtcgaggtatggagtgagggaaagcaacgacaaggaagagtatcttggaaatcatttgtgcatgacaatcatctcaaagtaggggatgcctgtgtgtttgagctgaaaaagggatgcgaagttccaacgtttaaagttcacatattccgagctgaagatgcagatgcgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006950 GO:0008150 GO:0009266 GO:0009409 GO:0009628 GO:0009909 GO:0010048 GO:0031974 GO:0031981 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043565 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0048580 GO:0048831 GO:0050789 GO:0050793 GO:0050896 GO:0051239 GO:0065007 GO:0070013 GO:0097159 GO:1901363 GO:2000026 GO:2000241

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

90

Amino Acids

10.1

Weight (kDa)

9.07

Isoelectric Point (pI)

33.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004836)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g13840 FvH4_1g14720 FvH4_2g29240 FvH4_2g29322 FvH4_2g29350 FvH4_3g34770 FvH4_7g25080
malus_domestica	MD05G1037200.v1.1
prunus_persica	Prupe.7G143200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0103581 RchiOBHm_Chr5g0062511
rosa_laevigata	RLG00000017246 RLG00000035562
rosa_multiflora	Rmu_co8088552.1_g000001 Rmu_sc0001530.1_g000008 Rmu_sc0001852.1_g000021 Rmu_sc0004988.1_g000026
rosa_roxburghii	Rroxscaffold_1G00018100 Rroxscaffold_2G00139510
rosa_rugosa	Rorug02G0115900 Rorug05G0350300 Rorug05G0350300
rosa_samantha	Rh2AG164200 Rh2BG171400 Rh2CG170900 Rh2DG169500 Rh5AG410300 Rh5BG424300 Rh5DG438600
rosa_wichuraiana	Rw2G012910 Rw5G038630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	230
AcsI	RAATTY	2 cut(s)	67, 81
AjuI	GAANNNNNNNTTGG	2 cut(s)	130, 162
AloI	GAACNNNNNNTCC	2 cut(s)	207, 239
AluBI	AGCT	2 cut(s)	205, 254
AluI	AGCT	2 cut(s)	205, 254
AoxI	GGCC	1 cut(s)	86
ApoI	RAATTY	2 cut(s)	67, 81
BfaI	CTAG	1 cut(s)	39
BfmI	CTRYAG	1 cut(s)	62
BmiI	GGNNCC	1 cut(s)	13
BmsI	GCATC	4 cut(s)	178, 206, 250, 256
BseGI	GGATG	2 cut(s)	193, 221
BseYI	CCCAGC	1 cut(s)	74
BshFI	GGCC	1 cut(s)	88
BsnI	GGCC	1 cut(s)	88
BspANI	GGCC	1 cut(s)	88
BspLI	GGNNCC	1 cut(s)	13
Bst4CI	ACNGT	1 cut(s)	103
Bst6I	CTCTTC	1 cut(s)	133
BstC8I	GCNNGC	1 cut(s)	90
BstF5I	GGATG	2 cut(s)	193, 221
BstMWI	GCNNNNNNNGC	1 cut(s)	260
BstSFI	CTRYAG	1 cut(s)	62
BsuRI	GGCC	1 cut(s)	88
BtsCI	GGATG	2 cut(s)	193, 221
BtsIMutI	CAGTG	1 cut(s)	99
Cac8I	GCNNGC	1 cut(s)	90
CviAII	CATG	1 cut(s)	164
CviJI	RGCY	5 cut(s)	14, 74, 88, 205, 254
CviKI_1	RGCY	5 cut(s)	14, 74, 88, 205, 254
DraI	TTTAAA	1 cut(s)	235
Eam1104I	CTCTTC	1 cut(s)	133
EarI	CTCTTC	1 cut(s)	133
EcoRI	GAATTC	1 cut(s)	67
FaeI	CATG	1 cut(s)	167
FaiI	YATR	3 cut(s)	112, 165, 245
FalI	AAGNNNNNCTT	2 cut(s)	130, 162
FatI	CATG	1 cut(s)	163
FokI	GGATG	2 cut(s)	200, 228
FspBI	CTAG	1 cut(s)	39
GsaI	CCCAGC	1 cut(s)	78
HaeIII	GGCC	1 cut(s)	88
Hin1II	CATG	1 cut(s)	167
HincII	GTYRAC	1 cut(s)	58
HindII	GTYRAC	1 cut(s)	58
HpaI	GTTAAC	1 cut(s)	58
Hpy166II	GTNNAC	3 cut(s)	58, 99, 241
Hpy188I	TCNGA	1 cut(s)	251
Hpy8I	GTNNAC	3 cut(s)	58, 99, 241
HpyCH4III	ACNGT	1 cut(s)	103
HpyCH4IV	ACGT	2 cut(s)	95, 230
HpyCH4V	TGCA	3 cut(s)	20, 163, 263
HpyF10VI	GCNNNNNNNGC	1 cut(s)	260
HpySE526I	ACGT	2 cut(s)	95, 230
Hsp92II	CATG	1 cut(s)	167
KspAI	GTTAAC	1 cut(s)	58
LmnI	GCTCC	1 cut(s)	11
LpnPI	CCDG	3 cut(s)	60, 102, 205
LweI	GCATC	4 cut(s)	178, 206, 250, 256
MaeI	CTAG	1 cut(s)	39
MaeII	ACGT	2 cut(s)	95, 230
MboII	GAAGA	2 cut(s)	150, 269
MluCI	AATT	3 cut(s)	2, 67, 81
MmeI	TCCRAC	1 cut(s)	251
MnlI	CCTC	3 cut(s)	35, 100, 112
MseI	TTAA	2 cut(s)	57, 234
MwoI	GCNNNNNNNGC	1 cut(s)	260
NlaIII	CATG	1 cut(s)	167
NlaIV	GGNNCC	1 cut(s)	13
Psp1406I	AACGTT	1 cut(s)	230
PspFI	CCCAGC	1 cut(s)	74
PspN4I	GGNNCC	1 cut(s)	13
SaqAI	TTAA	2 cut(s)	57, 234
SetI	ASST	7 cut(s)	46, 63, 98, 111, 207, 233, 256
SfaNI	GCATC	4 cut(s)	178, 206, 250, 256
SfcI	CTRYAG	1 cut(s)	62
Sse9I	AATT	3 cut(s)	2, 67, 81
SspMI	CTAG	1 cut(s)	39
TaaI	ACNGT	1 cut(s)	103
TaiI	ACGT	2 cut(s)	98, 233
TaqI	TCGA	1 cut(s)	105
TasI	AATT	3 cut(s)	2, 67, 81
Tru1I	TTAA	2 cut(s)	57, 234
Tru9I	TTAA	2 cut(s)	57, 234
TscAI	CASTG	1 cut(s)	106
TspRI	CASTG	1 cut(s)	106
XapI	RAATTY	2 cut(s)	67, 81
XspI	CTAG	1 cut(s)	39

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.