Rmu_sc0004988.1_g000026

B3 domain-containing

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004988.1
Physical Location & Seq
Forward (+)
81843 .. 86808
4966 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004988.1_g000026.1.cds

Sequence Viewer

Length: 1017 bp
atgtttgcggtcgattgttttatctcaacaaactctaagtttggagaactctacaagctccaagcttggagcgagcacgaacccccacatgggtccctgtatgctgacgtgtcagtgggtcagggtgctgacatggcggtgggagcttccgatggcaggttcggtaggtttcccgcaggttcttggggtggggcatccggttctggactcctgggatcgagttcttcaatgtgtgagcctctaaaccttgctcgtccggaagtggtcggcatctcttggttgcgctgctaccggatgggcggtgggattctaaagtctgtccttgggatgactcgatataatggcttcgatagtggcaatgcggtgaagtatggcgggtggttactagatgtggcagtgatgcgtgcaacaggacgcactggaagagtagattggaatgatgccaggagaaagagcagtgctaaaggagttgcctctccaagcttcttcaaggttgttgtggatgaggttcttgaagatgggatgcttgaaattgaaggttatgttgcgaggaactatgaagatttcctgggatgctcagtagtcctcactgatccgaaaggttctatgtggccaatggaactcaaaaggagcaatggcagcgtttggttgaaaaatggaggtgatgaagcctttacaagagctaagaggttcaaatccaaccatccatgtcttgctgtcagaatgcaaccctcctacctgttaaggggtttgaaattgaatgcaacctttgtgaatgaaaatatctgtgcaacaggcgccactcgcaaaatcaagctacagattccaaatgggaaaacctggtctgcaaagtgctctgtctacttatgcatgaacaaagactatgcaaaaatctgcagtggttggacaaagtttgcagcggaaaataagctgcaagtaggggatgcttgtgcgttggagctgataaaggagtgccctaaacttacattcttggttcacatattccgagctaattaa

Protein Analysis

338

Amino Acids

36.91

Weight (kDa)

9.11

Isoelectric Point (pI)

30.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 147, 167
AccB1I GGYRCC 1 cut(s) 797
AccI GTMKAC 1 cut(s) 861
AccIII TCCGGA 1 cut(s) 256
AciI CCGC 7 cut(s) 8, 137, 174, 300, 362, 375, 920
AclWI GGATC 2 cut(s) 223, 587
AcoI YGGCCR 1 cut(s) 611
AcyI GRCGYC 1 cut(s) 798
AfiI CCNNNNNNNGG 4 cut(s) 89, 90, 156, 745
AflIII ACRYGT 1 cut(s) 108
AgsI TTSAA 9 cut(s) 228, 490, 515, 530, 536, 652, 694, 754, 760
AjiI CACGTC 1 cut(s) 109
AjnI CCWGG 4 cut(s) 210, 443, 567, 839
AjuI GAANNNNNNNTTGG 2 cut(s) 415, 447
AluBI AGCT 9 cut(s) 58, 65, 146, 483, 683, 817, 931, 961, 1010
AluI AGCT 9 cut(s) 58, 65, 146, 483, 683, 817, 931, 961, 1010
Alw21I GWGCWC 2 cut(s) 78, 857
AlwI GGATC 2 cut(s) 223, 587
Aor13HI TCCGGA 1 cut(s) 256
AoxI GGCC 1 cut(s) 611
ApeKI GCWGC 4 cut(s) 285, 639, 917, 931
AspLEI GCGC 2 cut(s) 285, 800
AspS9I GGNCC 1 cut(s) 93
AsuHPI GGTGA 2 cut(s) 376, 674
AvaII GGWCC 1 cut(s) 93
BaeGI GKGCMC 1 cut(s) 977
BalI TGGCCA 1 cut(s) 613
BanI GGYRCC 1 cut(s) 797
Bbv12I GWGCWC 2 cut(s) 78, 857
BbvI GCAGC 4 cut(s) 272, 651, 918, 929
BccI CCATC 4 cut(s) 146, 289, 512, 711
BciT130I CCWGG 4 cut(s) 212, 445, 569, 841
BfaI CTAG 1 cut(s) 386
BfmI CTRYAG 2 cut(s) 818, 895
BfoI RGCGCY 1 cut(s) 801
BfuAI ACCTGC 2 cut(s) 147, 167
BisI GCNGC 4 cut(s) 286, 640, 918, 932
BlsI GCNGC 4 cut(s) 287, 641, 919, 933
Bme1390I CCNGG 4 cut(s) 212, 445, 569, 841
Bme18I GGWCC 1 cut(s) 93
BmgBI CACGTC 1 cut(s) 109
BmgT120I GGNCC 1 cut(s) 93
BmiI GGNNCC 3 cut(s) 94, 95, 799
BmrFI CCNGG 4 cut(s) 212, 445, 569, 841
BmsI GCATC 7 cut(s) 203, 279, 390, 430, 513, 563, 934
BsaHI GRCGYC 1 cut(s) 798
BsaJI CCNNGG 3 cut(s) 211, 322, 568
BsaWI WCCGGW 3 cut(s) 197, 256, 291
Bsc4I CCNNNNNNNGG 4 cut(s) 89, 90, 156, 745
Bse1I ACTGG 1 cut(s) 424
Bse3DI GCAATG 2 cut(s) 364, 640
BseAI TCCGGA 1 cut(s) 256
BseBI CCWGG 4 cut(s) 212, 445, 569, 841
BseDI CCNNGG 3 cut(s) 211, 322, 568
BseGI GGATG 8 cut(s) 194, 300, 333, 508, 528, 578, 703, 949
BseLI CCNNNNNNNGG 4 cut(s) 89, 90, 156, 745
BseMI GCAATG 2 cut(s) 364, 640
BseMII CTCAG 1 cut(s) 591
BseNI ACTGG 1 cut(s) 424
BseSI GKGCMC 1 cut(s) 977
BseXI GCAGC 4 cut(s) 272, 651, 918, 929
Bsh1285I CGRYCG 1 cut(s) 12
BshFI GGCC 1 cut(s) 613
BshNI GGYRCC 1 cut(s) 797
BsiEI CGRYCG 1 cut(s) 12
BsiHKAI GWGCWC 2 cut(s) 78, 857
BsiSI CCGG 3 cut(s) 198, 257, 292
BslFI GGGAC 1 cut(s) 79
BslI CCNNNNNNNGG 4 cut(s) 89, 90, 156, 745
BsmFI GGGAC 1 cut(s) 79
BsmI GAATGC 2 cut(s) 729, 766
BsnI GGCC 1 cut(s) 613
Bsp1286I GDGCHC 3 cut(s) 78, 857, 977
Bsp13I TCCGGA 1 cut(s) 256
Bsp143I GATC 2 cut(s) 215, 592
BspACI CCGC 7 cut(s) 8, 137, 174, 300, 362, 375, 920
BspANI GGCC 1 cut(s) 613
BspCNI CTCAG 1 cut(s) 590
BspEI TCCGGA 1 cut(s) 256
BspLI GGNNCC 3 cut(s) 94, 95, 799
BspMAI CTGCAG 1 cut(s) 899
BspMI ACCTGC 2 cut(s) 147, 167
BspPI GGATC 2 cut(s) 223, 587
BspT107I GGYRCC 1 cut(s) 797
BsrDI GCAATG 2 cut(s) 364, 640
BsrI ACTGG 1 cut(s) 424
BssECI CCNNGG 3 cut(s) 211, 322, 568
BssMI GATC 2 cut(s) 215, 592
BssNI GRCGYC 1 cut(s) 798
BssT1I CCWWGG 1 cut(s) 322
Bst2UI CCWGG 4 cut(s) 212, 445, 569, 841
Bst6I CTCTTC 1 cut(s) 418
BstACI GRCGYC 1 cut(s) 798
BstC8I GCNNGC 2 cut(s) 74, 405
BstDEI CTNAG 3 cut(s) 36, 577, 684
BstF5I GGATG 8 cut(s) 194, 300, 333, 508, 528, 578, 703, 949
BstH2I RGCGCY 1 cut(s) 801
BstHHI GCGC 2 cut(s) 285, 800
BstKTI GATC 2 cut(s) 218, 595
BstMBI GATC 2 cut(s) 215, 592
BstMCI CGRYCG 1 cut(s) 12
BstMWI GCNNNNNNNGC 5 cut(s) 134, 143, 639, 797, 804
BstNI CCWGG 4 cut(s) 212, 445, 569, 841
BstSCI CCNGG 4 cut(s) 210, 443, 567, 839
BstSFI CTRYAG 2 cut(s) 818, 895
BstSLI GKGCMC 1 cut(s) 977
BstV1I GCAGC 4 cut(s) 272, 651, 918, 929
BsuRI GGCC 1 cut(s) 613
BtrI CACGTC 1 cut(s) 109
BtsCI GGATG 8 cut(s) 194, 300, 333, 508, 528, 578, 703, 949
BtsI GCAGTG 3 cut(s) 402, 463, 904
BtsIMutI CAGTG 6 cut(s) 120, 402, 417, 463, 588, 904
BveI ACCTGC 2 cut(s) 147, 167
Cac8I GCNNGC 2 cut(s) 74, 405
CfoI GCGC 2 cut(s) 285, 800
Cfr13I GGNCC 1 cut(s) 93
CseI GACGC 1 cut(s) 423
CsiI ACCWGGT 1 cut(s) 839
CviAII CATG 4 cut(s) 89, 133, 708, 871
DdeI CTNAG 3 cut(s) 36, 577, 684
DinI GGCGCC 1 cut(s) 799
DpnI GATC 2 cut(s) 217, 594
DpnII GATC 2 cut(s) 215, 592
EaeI YGGCCR 1 cut(s) 611
Eam1104I CTCTTC 1 cut(s) 418
EarI CTCTTC 1 cut(s) 418
Eco130I CCWWGG 1 cut(s) 322
Eco47I GGWCC 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 93
EcoRII CCWGG 4 cut(s) 210, 443, 567, 839
EcoT14I CCWWGG 1 cut(s) 322
EcoT22I ATGCAT 1 cut(s) 872
EgeI GGCGCC 1 cut(s) 799
EheI GGCGCC 1 cut(s) 799
ErhI CCWWGG 1 cut(s) 322
FaeI CATG 4 cut(s) 92, 136, 711, 874
FaqI GGGAC 1 cut(s) 79
FatI CATG 4 cut(s) 88, 132, 707, 870
FauI CCCGC 2 cut(s) 181, 368
FblI GTMKAC 1 cut(s) 861
Fnu4HI GCNGC 4 cut(s) 286, 640, 918, 932
FokI GGATG 8 cut(s) 181, 307, 340, 515, 535, 585, 690, 956
Fsp4HI GCNGC 4 cut(s) 286, 640, 918, 932
FspBI CTAG 1 cut(s) 386
GlaI GCGC 2 cut(s) 284, 799
GluI GCNGC 4 cut(s) 286, 640, 918, 932
HaeII RGCGCY 1 cut(s) 801
HaeIII GGCC 1 cut(s) 613
HapII CCGG 3 cut(s) 198, 257, 292
HgaI GACGC 1 cut(s) 423
HhaI GCGC 2 cut(s) 285, 800
Hin1I GRCGYC 1 cut(s) 798
Hin1II CATG 4 cut(s) 92, 136, 711, 874
Hin6I GCGC 2 cut(s) 283, 798
HinP1I GCGC 2 cut(s) 283, 798
HindIII AAGCTT 2 cut(s) 63, 481
HinfI GANTC 4 cut(s) 207, 307, 331, 823
HpaII CCGG 3 cut(s) 198, 257, 292
HphI GGTGA 2 cut(s) 376, 674
Hpy166II GTNNAC 2 cut(s) 862, 997
Hpy188I TCNGA 4 cut(s) 151, 597, 722, 1007
Hpy188III TCNNGA 3 cut(s) 204, 257, 512
Hpy8I GTNNAC 2 cut(s) 862, 997
HpyAV CCTTC 1 cut(s) 530
HpyCH4IV ACGT 1 cut(s) 108
HpyF10VI GCNNNNNNNGC 5 cut(s) 134, 143, 639, 797, 804
HpyF3I CTNAG 3 cut(s) 36, 577, 684
HpySE526I ACGT 1 cut(s) 108
Hsp92I GRCGYC 1 cut(s) 798
Hsp92II CATG 4 cut(s) 92, 136, 711, 874
HspAI GCGC 2 cut(s) 283, 798
KasI GGCGCC 1 cut(s) 797
KflI GGGWCCC 1 cut(s) 93
Kpn2I TCCGGA 1 cut(s) 256
Kzo9I GATC 2 cut(s) 215, 592
LmnI GCTCC 5 cut(s) 63, 69, 143, 630, 958
Lsp1109I GCAGC 4 cut(s) 272, 651, 918, 929
LweI GCATC 7 cut(s) 203, 279, 390, 430, 513, 563, 934
MabI ACCWGGT 1 cut(s) 839
MaeI CTAG 1 cut(s) 386
MaeII ACGT 1 cut(s) 108
MaeIII GTNAC 1 cut(s) 381
MalI GATC 2 cut(s) 217, 594
MboI GATC 2 cut(s) 215, 592
MboII GAAGA 5 cut(s) 216, 435, 478, 527, 572
MhlI GDGCHC 3 cut(s) 78, 857, 977
MlsI TGGCCA 1 cut(s) 613
MluCI AATT 3 cut(s) 531, 755, 1012
MluNI TGGCCA 1 cut(s) 613
Mly113I GGCGCC 1 cut(s) 798
MlyI GAGTC 2 cut(s) 201, 325
MmeI TCCRAC 3 cut(s) 723, 884, 936
MnlI CCTC 8 cut(s) 249, 484, 499, 543, 596, 653, 681, 742
Mox20I TGGCCA 1 cut(s) 613
Mph1103I ATGCAT 1 cut(s) 872
MroI TCCGGA 1 cut(s) 256
MscI TGGCCA 1 cut(s) 613
MseI TTAA 2 cut(s) 743, 1015
MslI CAYNNNNRTG 1 cut(s) 137
Msp20I TGGCCA 1 cut(s) 613
MspA1I CMGCKG 1 cut(s) 920
MspI CCGG 3 cut(s) 198, 257, 292
MspR9I CCNGG 4 cut(s) 212, 445, 569, 841
Mva1269I GAATGC 2 cut(s) 729, 766
MvaI CCWGG 4 cut(s) 212, 445, 569, 841
MwoI GCNNNNNNNGC 5 cut(s) 134, 143, 639, 797, 804
NarI GGCGCC 1 cut(s) 798
NdeII GATC 2 cut(s) 215, 592
NlaIII CATG 4 cut(s) 92, 136, 711, 874
NlaIV GGNNCC 3 cut(s) 94, 95, 799
NsiI ATGCAT 1 cut(s) 872
PctI GAATGC 2 cut(s) 729, 766
PfeI GAWTC 2 cut(s) 307, 823
PkrI GCNGC 4 cut(s) 287, 641, 919, 933
PleI GAGTC 2 cut(s) 201, 325
PluTI GGCGCC 1 cut(s) 801
PpsI GAGTC 2 cut(s) 201, 325
PpuMI RGGWCCY 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 93
Psp6I CCWGG 4 cut(s) 210, 443, 567, 839
PspGI CCWGG 4 cut(s) 210, 443, 567, 839
PspN4I GGNNCC 3 cut(s) 94, 95, 799
PspPI GGNCC 1 cut(s) 93
PspPPI RGGWCCY 1 cut(s) 93
PstI CTGCAG 1 cut(s) 899
RseI CAYNNNNRTG 1 cut(s) 137
SaqAI TTAA 2 cut(s) 743, 1015
SatI GCNGC 4 cut(s) 286, 640, 918, 932
Sau3AI GATC 2 cut(s) 215, 592
Sau96I GGNCC 1 cut(s) 93
SchI GAGTC 2 cut(s) 201, 325
ScrFI CCNGG 4 cut(s) 212, 445, 569, 841
SduI GDGCHC 3 cut(s) 78, 857, 977
SexAI ACCWGGT 1 cut(s) 839
SfaNI GCATC 7 cut(s) 203, 279, 390, 430, 513, 563, 934
SfcI CTRYAG 2 cut(s) 818, 895
SfoI GGCGCC 1 cut(s) 799
SinI GGWCC 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 137
Sse9I AATT 3 cut(s) 531, 755, 1012
SsiI CCGC 7 cut(s) 8, 137, 174, 300, 362, 375, 920
SspDI GGCGCC 1 cut(s) 797
SspMI CTAG 1 cut(s) 386
StyD4I CCNGG 4 cut(s) 210, 443, 567, 839
StyI CCWWGG 1 cut(s) 322
TaiI ACGT 1 cut(s) 111
TaqI TCGA 4 cut(s) 12, 218, 334, 348
TasI AATT 3 cut(s) 531, 755, 1012
TfiI GAWTC 2 cut(s) 307, 823
Tru1I TTAA 2 cut(s) 743, 1015
Tru9I TTAA 2 cut(s) 743, 1015
TscAI CASTG 6 cut(s) 120, 402, 424, 463, 595, 904
TseI GCWGC 4 cut(s) 285, 639, 917, 931
TspDTI ATGAA 4 cut(s) 573, 681, 792, 887
TspRI CASTG 6 cut(s) 120, 402, 424, 463, 595, 904
VpaK11BI GGWCC 1 cut(s) 93
XmiI GTMKAC 1 cut(s) 861
XspI CTAG 1 cut(s) 386
Zsp2I ATGCAT 1 cut(s) 872
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.