Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001530.1

Orthogroup ID

OG0004836

Physical Location & Seq

Genomic Coordinates Reverse (-)

25152 .. 26769

Gene Structure 1618 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001530.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1002 bp

atgagagaaacagatcaagagccttctccttttgccgccaaatctccaagcttcttcaagatcgttcttgacagtgcacttcgagatggaaagattgaaattccaaaggcatttgtgatgaagcatggaaattctttggcagagtcagtattgcttaaggttcctagcagagcagaatggcgaataggattgacaaggtgtgatggtgaggtttggttagaaaagggctggccagaattcgcaaagttttacttcctagatcatggatacttattagtgttcagttgtgaaggtcattattccagtttccaagtgcaaatttttagtaggaatgctttggagatagattatcccatgaattcaagccttggcgagggtaaagaacttgaagatgatgatgtttctgttgaaatattggatgtggttccctcaaagaaaagagggagaagagaattggcaggcctttggcctcataagacgatgaggacaaaatcaggtgatgaagctgaagtgaattcctaccacagaggtaaaactaaacatcaaggagtggagcatcaaagagaaaagagaagttatggtactcctagttccttaaagaattgtcaagaggctaatgagcatgatgttgatacaagagatggagcgtttctgagagctacaagtttcaagtatagtaatccatatcttgtagtcagaatgcaaaaatcatacctatcaagatatttgaaattacaaggagcctttgcaaaagaatgtgtttgtgctagaggtgttcgtattgttaacctacagaattcgtctgggagaatttggcctgctacgttcactgtcgaggtatggagtgagggaaagcaacgacaaggaagagtatcttggaaatcatttgtgcatgacaatcatctcaaagtaggggatgcctgtgtgtttgagctgaaaaagggatgcgaagttccaacgtttaaagttcacatattccgagctgaagatgcagatgcgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006950 GO:0008150 GO:0009266 GO:0009409 GO:0009628 GO:0009909 GO:0010048 GO:0031974 GO:0031981 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043565 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0048580 GO:0048831 GO:0050789 GO:0050793 GO:0050896 GO:0051239 GO:0065007 GO:0070013 GO:0097159 GO:1901363 GO:2000026 GO:2000241

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

333

Amino Acids

37.99

Weight (kDa)

8.69

Isoelectric Point (pI)

38.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004836)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g13840 FvH4_1g14720 FvH4_2g29240 FvH4_2g29322 FvH4_2g29350 FvH4_3g34770 FvH4_7g25080
malus_domestica	MD05G1037200.v1.1
prunus_persica	Prupe.7G143200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0103581 RchiOBHm_Chr5g0062511
rosa_laevigata	RLG00000017246 RLG00000035562
rosa_multiflora	Rmu_co8088552.1_g000001 Rmu_sc0001530.1_g000008 Rmu_sc0001852.1_g000021 Rmu_sc0004988.1_g000026
rosa_roxburghii	Rroxscaffold_1G00018100 Rroxscaffold_2G00139510
rosa_rugosa	Rorug02G0115900 Rorug05G0350300 Rorug05G0350300
rosa_samantha	Rh2AG164200 Rh2BG171400 Rh2CG170900 Rh2DG169500 Rh5AG410300 Rh5BG424300 Rh5DG438600
rosa_wichuraiana	Rw2G012910 Rw5G038630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	36
AclI	AACGTT	1 cut(s)	959
AcoI	YGGCCR	1 cut(s)	230
AcsI	RAATTY	8 cut(s)	99, 130, 236, 318, 358, 514, 796, 810
AcuI	CTGAAG	1 cut(s)	528
AfaI	GTAC	1 cut(s)	583
AfiI	CCNNNNNNNGG	1 cut(s)	373
AflII	CTTAAG	1 cut(s)	155
AgsI	TTSAA	7 cut(s)	58, 98, 363, 389, 410, 670, 730
AjuI	GAANNNNNNNTTGG	2 cut(s)	859, 891
AloI	GAACNNNNNNTCC	2 cut(s)	936, 968
AluBI	AGCT	5 cut(s)	51, 506, 659, 934, 983
AluI	AGCT	5 cut(s)	51, 506, 659, 934, 983
Alw21I	GWGCWC	1 cut(s)	79
Alw44I	GTGCAC	1 cut(s)	75
AoxI	GGCC	4 cut(s)	230, 460, 467, 815
ApaLI	GTGCAC	1 cut(s)	75
ApoI	RAATTY	8 cut(s)	99, 130, 236, 318, 358, 514, 796, 810
AsuHPI	GGTGA	2 cut(s)	218, 509
BaeGI	GKGCMC	1 cut(s)	79
BalI	TGGCCA	1 cut(s)	232
BarI	GAAGNNNNNNTAC	2 cut(s)	565, 597
Bbv12I	GWGCWC	1 cut(s)	79
BccI	CCATC	3 cut(s)	80, 197, 635
BciVI	GTATCC	1 cut(s)	260
BfaI	CTAG	4 cut(s)	165, 257, 588, 768
BfmI	CTRYAG	1 cut(s)	791
BfrI	CTTAAG	1 cut(s)	155
BfuI	GTATCC	1 cut(s)	260
BisI	GCNGC	1 cut(s)	36
BlsI	GCNGC	1 cut(s)	37
BmiI	GGNNCC	3 cut(s)	162, 426, 742
BmsI	GCATC	5 cut(s)	565, 907, 935, 979, 985
BsaJI	CCNNGG	1 cut(s)	367
Bsc4I	CCNNNNNNNGG	1 cut(s)	373
Bse1I	ACTGG	1 cut(s)	303
BseDI	CCNNGG	1 cut(s)	367
BseGI	GGATG	3 cut(s)	424, 922, 950
BseLI	CCNNNNNNNGG	1 cut(s)	373
BseMII	CTCAG	1 cut(s)	644
BseNI	ACTGG	1 cut(s)	303
BseSI	GKGCMC	1 cut(s)	79
BshFI	GGCC	4 cut(s)	232, 462, 469, 817
BsiHKAI	GWGCWC	1 cut(s)	79
BslI	CCNNNNNNNGG	1 cut(s)	373
BsmI	GAATGC	2 cut(s)	337, 705
BsnI	GGCC	4 cut(s)	232, 462, 469, 817
Bsp1286I	GDGCHC	1 cut(s)	79
Bsp143I	GATC	3 cut(s)	13, 60, 259
BspACI	CCGC	1 cut(s)	36
BspANI	GGCC	4 cut(s)	232, 462, 469, 817
BspCNI	CTCAG	1 cut(s)	645
BspLI	GGNNCC	3 cut(s)	162, 426, 742
BspTI	CTTAAG	1 cut(s)	155
BsrI	ACTGG	1 cut(s)	303
BssECI	CCNNGG	1 cut(s)	367
BssMI	GATC	3 cut(s)	13, 60, 259
BssT1I	CCWWGG	1 cut(s)	367
Bst4CI	ACNGT	2 cut(s)	74, 832
Bst6I	CTCTTC	2 cut(s)	442, 862
BstAFI	CTTAAG	1 cut(s)	155
BstC8I	GCNNGC	3 cut(s)	230, 460, 819
BstDEI	CTNAG	1 cut(s)	653
BstENI	CCTNNNNNAGG	1 cut(s)	371
BstF5I	GGATG	3 cut(s)	424, 922, 950
BstKTI	GATC	3 cut(s)	16, 63, 262
BstMBI	GATC	3 cut(s)	13, 60, 259
BstMWI	GCNNNNNNNGC	1 cut(s)	989
BstSFI	CTRYAG	1 cut(s)	791
BstSLI	GKGCMC	1 cut(s)	79
BsuI	GTATCC	1 cut(s)	260
BsuRI	GGCC	4 cut(s)	232, 462, 469, 817
BtsCI	GGATG	3 cut(s)	424, 922, 950
BtsIMutI	CAGTG	2 cut(s)	79, 828
Cac8I	GCNNGC	3 cut(s)	230, 460, 819
Csp6I	GTAC	1 cut(s)	582
CviAII	CATG	5 cut(s)	125, 263, 355, 623, 893
CviQI	GTAC	1 cut(s)	582
DdeI	CTNAG	1 cut(s)	653
DpnI	GATC	3 cut(s)	15, 62, 261
DpnII	GATC	3 cut(s)	13, 60, 259
DraI	TTTAAA	1 cut(s)	964
EaeI	YGGCCR	1 cut(s)	230
Eam1104I	CTCTTC	2 cut(s)	442, 862
EarI	CTCTTC	2 cut(s)	442, 862
Eco130I	CCWWGG	1 cut(s)	367
Eco147I	AGGCCT	1 cut(s)	462
Eco57I	CTGAAG	1 cut(s)	528
EcoNI	CCTNNNNNAGG	1 cut(s)	371
EcoRI	GAATTC	4 cut(s)	236, 358, 514, 796
EcoT14I	CCWWGG	1 cut(s)	367
ErhI	CCWWGG	1 cut(s)	367
FaeI	CATG	5 cut(s)	128, 266, 358, 626, 896
FalI	AAGNNNNNCTT	4 cut(s)	236, 268, 859, 891
FatI	CATG	5 cut(s)	124, 262, 354, 622, 892
Fnu4HI	GCNGC	1 cut(s)	36
FokI	GGATG	3 cut(s)	431, 929, 957
Fsp4HI	GCNGC	1 cut(s)	36
FspBI	CTAG	4 cut(s)	165, 257, 588, 768
GluI	GCNGC	1 cut(s)	36
HaeIII	GGCC	4 cut(s)	232, 462, 469, 817
Hin1II	CATG	5 cut(s)	128, 266, 358, 626, 896
HincII	GTYRAC	1 cut(s)	787
HindII	GTYRAC	1 cut(s)	787
HindIII	AAGCTT	1 cut(s)	49
HinfI	GANTC	1 cut(s)	143
HpaI	GTTAAC	1 cut(s)	787
HphI	GGTGA	2 cut(s)	218, 509
Hpy166II	GTNNAC	4 cut(s)	77, 787, 828, 970
Hpy188I	TCNGA	3 cut(s)	654, 698, 980
Hpy188III	TCNNGA	6 cut(s)	17, 58, 68, 83, 608, 720
Hpy8I	GTNNAC	4 cut(s)	77, 787, 828, 970
HpyAV	CCTTC	2 cut(s)	33, 284
HpyCH4III	ACNGT	2 cut(s)	74, 832
HpyCH4IV	ACGT	2 cut(s)	824, 959
HpyCH4V	TGCA	6 cut(s)	77, 316, 703, 749, 892, 992
HpyF10VI	GCNNNNNNNGC	1 cut(s)	989
HpyF3I	CTNAG	1 cut(s)	653
HpySE526I	ACGT	2 cut(s)	824, 959
Hsp92II	CATG	5 cut(s)	128, 266, 358, 626, 896
KspAI	GTTAAC	1 cut(s)	787
Kzo9I	GATC	3 cut(s)	13, 60, 259
LmnI	GCTCC	3 cut(s)	553, 644, 740
LpnPI	CCDG	8 cut(s)	214, 246, 316, 444, 480, 789, 831, 934
LweI	GCATC	5 cut(s)	565, 907, 935, 979, 985
MaeI	CTAG	4 cut(s)	165, 257, 588, 768
MaeII	ACGT	2 cut(s)	824, 959
MalI	GATC	3 cut(s)	15, 62, 261
MboI	GATC	3 cut(s)	13, 60, 259
MboII	GAAGA	5 cut(s)	46, 401, 459, 879, 998
MhlI	GDGCHC	1 cut(s)	79
MlsI	TGGCCA	1 cut(s)	232
MluNI	TGGCCA	1 cut(s)	232
MlyI	GAGTC	1 cut(s)	152
MmeI	TCCRAC	1 cut(s)	980
Mox20I	TGGCCA	1 cut(s)	232
MscI	TGGCCA	1 cut(s)	232
MseI	TTAA	4 cut(s)	156, 596, 786, 963
Msp20I	TGGCCA	1 cut(s)	232
MspCI	CTTAAG	1 cut(s)	155
Mva1269I	GAATGC	2 cut(s)	337, 705
MwoI	GCNNNNNNNGC	1 cut(s)	989
NdeII	GATC	3 cut(s)	13, 60, 259
NlaIII	CATG	5 cut(s)	128, 266, 358, 626, 896
NlaIV	GGNNCC	3 cut(s)	162, 426, 742
PceI	AGGCCT	1 cut(s)	462
PctI	GAATGC	2 cut(s)	337, 705
PkrI	GCNGC	1 cut(s)	37
PleI	GAGTC	1 cut(s)	151
PpsI	GAGTC	1 cut(s)	151
Psp1406I	AACGTT	1 cut(s)	959
PspN4I	GGNNCC	3 cut(s)	162, 426, 742
PsrI	GAACNNNNNNTAC	2 cut(s)	574, 606
RsaI	GTAC	1 cut(s)	583
RsaNI	GTAC	1 cut(s)	582
SaqAI	TTAA	4 cut(s)	156, 596, 786, 963
SatI	GCNGC	1 cut(s)	36
Sau3AI	GATC	3 cut(s)	13, 60, 259
SchI	GAGTC	1 cut(s)	152
SduI	GDGCHC	1 cut(s)	79
SfaNI	GCATC	5 cut(s)	565, 907, 935, 979, 985
SfcI	CTRYAG	1 cut(s)	791
SmlI	CTYRAG	1 cut(s)	155
SmoI	CTYRAG	1 cut(s)	155
SseBI	AGGCCT	1 cut(s)	462
SsiI	CCGC	1 cut(s)	36
SspI	AATATT	1 cut(s)	414
SspMI	CTAG	4 cut(s)	165, 257, 588, 768
StuI	AGGCCT	1 cut(s)	462
StyI	CCWWGG	1 cut(s)	367
TaaI	ACNGT	2 cut(s)	74, 832
TaiI	ACGT	2 cut(s)	827, 962
TaqI	TCGA	2 cut(s)	82, 834
TauI	GCSGC	1 cut(s)	38
Tru1I	TTAA	4 cut(s)	156, 596, 786, 963
Tru9I	TTAA	4 cut(s)	156, 596, 786, 963
TscAI	CASTG	2 cut(s)	79, 835
TspDTI	ATGAA	3 cut(s)	134, 371, 516
TspRI	CASTG	2 cut(s)	79, 835
Vha464I	CTTAAG	1 cut(s)	155
VneI	GTGCAC	1 cut(s)	75
XagI	CCTNNNNNAGG	1 cut(s)	371
XapI	RAATTY	8 cut(s)	99, 130, 236, 318, 358, 514, 796, 810
XspI	CTAG	4 cut(s)	165, 257, 588, 768

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.