Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8300361.1

Orthogroup ID

OG0007545

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 682

Gene Structure 682 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8300361.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

aagttgccatctgcttttgtccagaaacatcttgataagaggcctagtcatgtcagcctgtggggttcaaatgacatatattggcctgtcgagttacatttccgcaaaggagctagcttccagggcggttggattgaatttgtgcaacgccataatctgaaagaaggtgatgcatgtggctttgagttgactgagaagagaaagtttctgtttgatgttcacattttccgcaccacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005886 GO:0006950 GO:0008104 GO:0008150 GO:0009266 GO:0009409 GO:0009628 GO:0009909 GO:0010048 GO:0016020 GO:0031974 GO:0031981 GO:0033036 GO:0034613 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043565 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0048580 GO:0048831 GO:0050789 GO:0050793 GO:0050896 GO:0051179 GO:0051239 GO:0051641 GO:0065007 GO:0070013 GO:0070727 GO:0071944 GO:0097159 GO:1901363 GO:2000026 GO:2000241

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

79

Amino Acids

9.32

Weight (kDa)

9.3

Isoelectric Point (pI)

53.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007545)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0103451 RchiOBHm_Chr2g0103461 RchiOBHm_Chr2g0103471 RchiOBHm_Chr2g0103481
rosa_laevigata	RLG00000017237 RLG00000017238 RLG00000017239
rosa_multiflora	Rmu_co8300361.1_g000001 Rmu_co8395735.1_g000001 Rmu_sc0001852.1_g000027 Rmu_sc0011039.1_g000006
rosa_roxburghii	Rroxscaffold_2G00139600 Rroxscaffold_2G00139610 Rroxscaffold_2G00139620
rosa_rugosa	Rorug02G0115000 Rorug02G0115100
rosa_samantha	Rh2AG163400 Rh2AG163500 Rh2AG163600 Rh2BG170500 Rh2BG170600 Rh2BG170700 Rh2DG169000
rosa_wichuraiana	Rw2G012850 Rw2G012860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	103, 126, 229
AcsI	RAATTY	1 cut(s)	137
AgsI	TTSAA	2 cut(s)	69, 137
AjnI	CCWGG	1 cut(s)	120
AluBI	AGCT	2 cut(s)	113, 117
AluI	AGCT	2 cut(s)	113, 117
AoxI	GGCC	2 cut(s)	41, 83
ApoI	RAATTY	1 cut(s)	137
AsuHPI	GGTGA	1 cut(s)	179
AsuNHI	GCTAGC	1 cut(s)	113
BccI	CCATC	1 cut(s)	16
BciT130I	CCWGG	1 cut(s)	122
BfaI	CTAG	2 cut(s)	45, 114
Bme1390I	CCNGG	1 cut(s)	122
BmrFI	CCNGG	1 cut(s)	122
BmsI	GCATC	1 cut(s)	160
BmtI	GCTAGC	1 cut(s)	117
BsaJI	CCNNGG	1 cut(s)	121
BseBI	CCWGG	1 cut(s)	122
BseDI	CCNNGG	1 cut(s)	121
BseMII	CTCAG	1 cut(s)	183
BshFI	GGCC	2 cut(s)	43, 85
BsnI	GGCC	2 cut(s)	43, 85
BspACI	CCGC	3 cut(s)	103, 126, 229
BspANI	GGCC	2 cut(s)	43, 85
BspCNI	CTCAG	1 cut(s)	184
BspOI	GCTAGC	1 cut(s)	117
BssECI	CCNNGG	1 cut(s)	121
Bst2UI	CCWGG	1 cut(s)	122
Bst6I	CTCTTC	1 cut(s)	191
BstC8I	GCNNGC	1 cut(s)	115
BstDEI	CTNAG	1 cut(s)	192
BstMWI	GCNNNNNNNGC	1 cut(s)	123
BstNI	CCWGG	1 cut(s)	122
BstNSI	RCATGY	1 cut(s)	177
BstSCI	CCNGG	1 cut(s)	120
BsuRI	GGCC	2 cut(s)	43, 85
Cac8I	GCNNGC	1 cut(s)	115
CviAII	CATG	2 cut(s)	50, 174
CviJI	RGCY	6 cut(s)	43, 57, 85, 113, 117, 180
CviKI_1	RGCY	6 cut(s)	43, 57, 85, 113, 117, 180
DdeI	CTNAG	1 cut(s)	192
Eam1104I	CTCTTC	1 cut(s)	191
EarI	CTCTTC	1 cut(s)	191
Eco147I	AGGCCT	1 cut(s)	43
EcoRII	CCWGG	1 cut(s)	120
EcoT22I	ATGCAT	1 cut(s)	175
FaeI	CATG	2 cut(s)	53, 177
FaiI	YATR	6 cut(s)	51, 77, 79, 153, 175, 238
FatI	CATG	2 cut(s)	49, 173
FspBI	CTAG	2 cut(s)	45, 114
HaeIII	GGCC	2 cut(s)	43, 85
Hin1II	CATG	2 cut(s)	53, 177
HincII	GTYRAC	1 cut(s)	189
HindII	GTYRAC	1 cut(s)	189
HphI	GGTGA	1 cut(s)	179
Hpy166II	GTNNAC	2 cut(s)	189, 220
Hpy188I	TCNGA	1 cut(s)	159
Hpy188III	TCNNGA	2 cut(s)	22, 32
Hpy8I	GTNNAC	2 cut(s)	189, 220
HpyAV	CCTTC	1 cut(s)	158
HpyCH4V	TGCA	2 cut(s)	145, 173
HpyF10VI	GCNNNNNNNGC	1 cut(s)	123
HpyF3I	CTNAG	1 cut(s)	192
Hsp92II	CATG	2 cut(s)	53, 177
LmnI	GCTCC	1 cut(s)	110
LpnPI	CCDG	5 cut(s)	35, 71, 99, 107, 134
LweI	GCATC	1 cut(s)	160
MaeI	CTAG	2 cut(s)	45, 114
MaeIII	GTNAC	1 cut(s)	93
MboII	GAAGA	1 cut(s)	208
MluCI	AATT	1 cut(s)	137
MmeI	TCCRAC	1 cut(s)	110
MnlI	CCTC	1 cut(s)	33
Mph1103I	ATGCAT	1 cut(s)	175
MspR9I	CCNGG	1 cut(s)	122
MvaI	CCWGG	1 cut(s)	122
MwoI	GCNNNNNNNGC	1 cut(s)	123
NheI	GCTAGC	1 cut(s)	113
NlaIII	CATG	2 cut(s)	53, 177
NsiI	ATGCAT	1 cut(s)	175
NspI	RCATGY	1 cut(s)	177
PceI	AGGCCT	1 cut(s)	43
Psp6I	CCWGG	1 cut(s)	120
PspGI	CCWGG	1 cut(s)	120
ScrFI	CCNGG	1 cut(s)	122
SetI	ASST	3 cut(s)	115, 119, 169
SfaNI	GCATC	1 cut(s)	160
Sse9I	AATT	1 cut(s)	137
SseBI	AGGCCT	1 cut(s)	43
SsiI	CCGC	3 cut(s)	103, 126, 229
SspMI	CTAG	2 cut(s)	45, 114
StuI	AGGCCT	1 cut(s)	43
StyD4I	CCNGG	1 cut(s)	120
TaqI	TCGA	1 cut(s)	90
TasI	AATT	1 cut(s)	137
XapI	RAATTY	1 cut(s)	137
XceI	RCATGY	1 cut(s)	177
XspI	CTAG	2 cut(s)	45, 114
Zsp2I	ATGCAT	1 cut(s)	175

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.