Rmu_co8322589.1_g000001

photo-lyase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8322589.1
Physical Location & Seq
Forward (+)
1 .. 577
577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8322589.1_g000001.1.cds

Sequence Viewer

Length: 305 bp
tctgcaggatgtattgggcaaaaaagatccttgagtggacaagaggacccgaagaagcccttgaaatatccatatatttaaataacaagtatgaaatggatggaagggatcccaatggatatgttggttgcatgtggtcaatatgtggtgttcacgaccagggttggaaggaacgaccaatttttgggaaaatacgttacatgaactatgcaggctgcaaaaggaaatttgacgttgatggatacgttgcctatgtgcagaggcttggtgcaaccaagaagagaaaactcctactcagtgaatag

Protein Analysis

100

Amino Acids

11.81

Weight (kDa)

9.21

Isoelectric Point (pI)

28.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 184
AclWI GGATC 3 cut(s) 21, 103, 116
AcsI RAATTY 1 cut(s) 226
AfiI CCNNNNNNNGG 1 cut(s) 184
AgsI TTSAA 1 cut(s) 64
AjnI CCWGG 1 cut(s) 158
AlwI GGATC 3 cut(s) 21, 103, 116
ApeKI GCWGC 1 cut(s) 215
ApoI RAATTY 1 cut(s) 226
AspS9I GGNCC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 46
BamHI GGATCC 1 cut(s) 108
BbvI GCAGC 1 cut(s) 202
BccI CCATC 2 cut(s) 94, 232
BciT130I CCWGG 1 cut(s) 160
BciVI GTATCC 1 cut(s) 235
BfmI CTRYAG 1 cut(s) 3
BfuI GTATCC 1 cut(s) 235
BisI GCNGC 1 cut(s) 216
BlsI GCNGC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 160
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BmiI GGNNCC 2 cut(s) 48, 110
BmrFI CCNGG 1 cut(s) 160
BpuEI CTTGAG 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 184
BseBI CCWGG 1 cut(s) 160
BseDI CCNNGG 1 cut(s) 159
BseGI GGATG 2 cut(s) 14, 105
BseLI CCNNNNNNNGG 1 cut(s) 184
BseXI GCAGC 1 cut(s) 202
BsgI GTGCAG 1 cut(s) 277
BslI CCNNNNNNNGG 1 cut(s) 184
Bsp143I GATC 2 cut(s) 26, 108
BspLI GGNNCC 2 cut(s) 48, 110
BspMAI CTGCAG 1 cut(s) 7
BspPI GGATC 3 cut(s) 21, 103, 116
BssECI CCNNGG 1 cut(s) 159
BssMI GATC 2 cut(s) 26, 108
Bst2UI CCWGG 1 cut(s) 160
Bst6I CTCTTC 1 cut(s) 274
BstC8I GCNNGC 1 cut(s) 213
BstDEI CTNAG 1 cut(s) 295
BstF5I GGATG 2 cut(s) 14, 105
BstKTI GATC 2 cut(s) 29, 111
BstMBI GATC 2 cut(s) 26, 108
BstNI CCWGG 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 158
BstSFI CTRYAG 1 cut(s) 3
BstV1I GCAGC 1 cut(s) 202
BstX2I RGATCY 2 cut(s) 26, 108
BstYI RGATCY 2 cut(s) 26, 108
BsuI GTATCC 1 cut(s) 235
BtsCI GGATG 2 cut(s) 14, 105
BtsIMutI CAGTG 1 cut(s) 303
Cac8I GCNNGC 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 46
CviAII CATG 2 cut(s) 132, 201
CviJI RGCY 3 cut(s) 58, 215, 264
CviKI_1 RGCY 3 cut(s) 58, 215, 264
DdeI CTNAG 1 cut(s) 295
DpnI GATC 2 cut(s) 28, 110
DpnII GATC 2 cut(s) 26, 108
DraI TTTAAA 1 cut(s) 80
Eam1104I CTCTTC 1 cut(s) 274
EarI CTCTTC 1 cut(s) 274
Eco47I GGWCC 1 cut(s) 46
EcoO109I RGGNCCY 1 cut(s) 46
EcoRII CCWGG 1 cut(s) 158
FaeI CATG 2 cut(s) 135, 204
FaiI YATR 9 cut(s) 73, 75, 92, 122, 133, 144, 202, 209, 254
FalI AAGNNNNNCTT 2 cut(s) 44, 76
FatI CATG 2 cut(s) 131, 200
Fnu4HI GCNGC 1 cut(s) 216
FokI GGATG 2 cut(s) 21, 112
Fsp4HI GCNGC 1 cut(s) 216
GluI GCNGC 1 cut(s) 216
Hin1II CATG 2 cut(s) 135, 204
Hpy166II GTNNAC 2 cut(s) 38, 153
Hpy188III TCNNGA 1 cut(s) 154
Hpy8I GTNNAC 2 cut(s) 38, 153
HpyAV CCTTC 2 cut(s) 98, 162
HpyCH4IV ACGT 3 cut(s) 195, 233, 245
HpyCH4V TGCA 6 cut(s) 5, 131, 211, 218, 258, 271
HpyF3I CTNAG 1 cut(s) 295
HpySE526I ACGT 3 cut(s) 195, 233, 245
Hsp92II CATG 2 cut(s) 135, 204
Kzo9I GATC 2 cut(s) 26, 108
LpnPI CCDG 3 cut(s) 145, 172, 197
Lsp1109I GCAGC 1 cut(s) 202
MaeII ACGT 3 cut(s) 195, 233, 245
MaeIII GTNAC 1 cut(s) 196
MalI GATC 2 cut(s) 28, 110
MboI GATC 2 cut(s) 26, 108
MboII GAAGA 2 cut(s) 64, 291
MflI RGATCY 2 cut(s) 26, 108
MluCI AATT 2 cut(s) 179, 226
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 2 cut(s) 37, 254
MseI TTAA 1 cut(s) 79
MspR9I CCNGG 1 cut(s) 160
MvaI CCWGG 1 cut(s) 160
NdeII GATC 2 cut(s) 26, 108
NlaIII CATG 2 cut(s) 135, 204
NlaIV GGNNCC 2 cut(s) 48, 110
NspI RCATGY 1 cut(s) 135
PflMI CCANNNNNTGG 1 cut(s) 184
PkrI GCNGC 1 cut(s) 217
PpuMI RGGWCCY 1 cut(s) 46
Psp5II RGGWCCY 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 158
PspGI CCWGG 1 cut(s) 158
PspN4I GGNNCC 2 cut(s) 48, 110
PspPI GGNCC 1 cut(s) 46
PspPPI RGGWCCY 1 cut(s) 46
PstI CTGCAG 1 cut(s) 7
PsuI RGATCY 2 cut(s) 26, 108
SaqAI TTAA 1 cut(s) 79
SatI GCNGC 1 cut(s) 216
Sau3AI GATC 2 cut(s) 26, 108
Sau96I GGNCC 1 cut(s) 46
ScrFI CCNGG 1 cut(s) 160
SetI ASST 3 cut(s) 198, 236, 248
SfcI CTRYAG 1 cut(s) 3
SinI GGWCC 1 cut(s) 46
SmiI ATTTAAAT 1 cut(s) 80
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
Sse9I AATT 2 cut(s) 179, 226
StyD4I CCNGG 1 cut(s) 158
SwaI ATTTAAAT 1 cut(s) 80
TaiI ACGT 3 cut(s) 198, 236, 248
TasI AATT 2 cut(s) 179, 226
Tru1I TTAA 1 cut(s) 79
Tru9I TTAA 1 cut(s) 79
TscAI CASTG 1 cut(s) 303
TseI GCWGC 1 cut(s) 215
TspDTI ATGAA 2 cut(s) 107, 217
TspRI CASTG 1 cut(s) 303
Van91I CCANNNNNTGG 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 46
XapI RAATTY 1 cut(s) 226
XceI RCATGY 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.