Rmu_co8339215.1_g000001

GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8339215.1
Physical Location & Seq
Reverse (-)
2 .. 938
937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8339215.1_g000001.1.cds

Sequence Viewer

Length: 937 bp
atggttttaaagaaactagagcagtttttctcaccaaaaagaaacttaatttctgggtttgttttgggaattggagtctctctcattgtactttttgtgagcaactccttaaggagtagtagtcctacacctacagtagaggaacaggggctttataatgtttttgtaaattcttcttttgtttcaactactgcacattccattgccccagaattgcagagttctactggagaatcaaatgagtctgtaattgctggagtagtcgaaaaatttgtggaggacaatgagaatggtacaatggtcttccagaaggcccagttgggaaatattacagaggaagttgacgatagaataagcttttgggttgaagaagaaagtgtccaactgaaagatgatagctttgattcatatggggaaggaagtgttctagggattgcccagttggggaatgttacagagcaagttaaaggtgaaagcttcggggttgaagaaggaagtgttcgacaaaaagatggcaactttgattcaaacggtgaaggagggattgcccatttggggaattcctctgagattttggaatttggaagattgcatggtgcaggtgggaaagcaacggggaaatcaagcgttgctggcaaagaggaaagcgttgaagctagtttttcaaacaattctaggagtgggaatggcatggtctcagaagatgtaaaaattgaaattattggctttgattctcaaacttgggaaatgcagagtgatgatgactctgatcagaaatgtgatatttatgatggtaaatgggtaagagatgattcaatgccatactatcctggaggttcttgtccgcacattgatagggattttaattgtcacctcaatcggaggccggacgatgagtttttgaaatggaaatggcagccatatgggtgcgacatct

Protein Analysis

312

Amino Acids

34.19

Weight (kDa)

4.45

Isoelectric Point (pI)

50.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 156
AarI CACCTGC 1 cut(s) 590
Acc36I ACCTGC 1 cut(s) 590
AciI CCGC 1 cut(s) 845
AcsI RAATTY 4 cut(s) 169, 269, 559, 578
AfaI GTAC 2 cut(s) 90, 295
AfiI CCNNNNNNNGG 2 cut(s) 444, 555
AflII CTTAAG 1 cut(s) 109
AgsI TTSAA 9 cut(s) 186, 368, 488, 528, 653, 666, 716, 816, 904
AjnI CCWGG 1 cut(s) 829
AjuI GAANNNNNNNTTGG 4 cut(s) 302, 334, 343, 375
AluBI AGCT 4 cut(s) 357, 399, 477, 656
AluI AGCT 4 cut(s) 357, 399, 477, 656
Alw26I GTCTC 2 cut(s) 82, 700
AoxI GGCC 2 cut(s) 312, 884
ApeKI GCWGC 1 cut(s) 916
ApoI RAATTY 4 cut(s) 169, 269, 559, 578
AspS9I GGNCC 1 cut(s) 313
AsuHPI GGTGA 4 cut(s) 24, 482, 545, 863
BaeI ACNNNNGTAYC 2 cut(s) 285, 318
BbsI GAAGAC 1 cut(s) 295
BbvI GCAGC 1 cut(s) 928
BccI CCATC 2 cut(s) 506, 785
BciT130I CCWGG 1 cut(s) 831
BclI TGATCA 1 cut(s) 769
BcoDI GTCTC 2 cut(s) 82, 700
BfaI CTAG 4 cut(s) 17, 428, 657, 675
BfmI CTRYAG 1 cut(s) 132
BfrI CTTAAG 1 cut(s) 109
BfuAI ACCTGC 1 cut(s) 590
BisI GCNGC 1 cut(s) 917
BlsI GCNGC 1 cut(s) 918
Bme1390I CCNGG 1 cut(s) 831
BmgT120I GGNCC 1 cut(s) 313
BmrFI CCNGG 1 cut(s) 831
BmrI ACTGGG 2 cut(s) 310, 433
BmuI ACTGGG 2 cut(s) 310, 433
BpiI GAAGAC 1 cut(s) 295
BplI GAGNNNNNCTC 2 cut(s) 66, 98
BpmI CTGGAG 3 cut(s) 249, 276, 852
BsaI GGTCTC 1 cut(s) 700
BsaXI ACNNNNNCTCC 2 cut(s) 106, 136
Bsc4I CCNNNNNNNGG 2 cut(s) 444, 555
Bse1I ACTGG 3 cut(s) 232, 316, 439
Bse3DI GCAATG 1 cut(s) 201
BseBI CCWGG 1 cut(s) 831
BseLI CCNNNNNNNGG 2 cut(s) 444, 555
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 2 cut(s) 558, 711
BseNI ACTGG 3 cut(s) 232, 316, 439
BseXI GCAGC 1 cut(s) 928
BsgI GTGCAG 2 cut(s) 177, 618
BshFI GGCC 2 cut(s) 314, 886
BsiSI CCGG 1 cut(s) 887
BslI CCNNNNNNNGG 2 cut(s) 444, 555
BsmAI GTCTC 2 cut(s) 82, 700
BsnI GGCC 2 cut(s) 314, 886
Bso31I GGTCTC 1 cut(s) 700
Bsp143I GATC 1 cut(s) 769
BspACI CCGC 1 cut(s) 845
BspANI GGCC 2 cut(s) 314, 886
BspCNI CTCAG 2 cut(s) 559, 710
BspMI ACCTGC 1 cut(s) 590
BspTI CTTAAG 1 cut(s) 109
BspTNI GGTCTC 1 cut(s) 700
BsrDI GCAATG 1 cut(s) 201
BsrI ACTGG 3 cut(s) 232, 316, 439
BssMI GATC 1 cut(s) 769
Bst2UI CCWGG 1 cut(s) 831
Bst4CI ACNGT 2 cut(s) 136, 533
BstAFI CTTAAG 1 cut(s) 109
BstC8I GCNNGC 1 cut(s) 634
BstDEI CTNAG 2 cut(s) 567, 697
BstKTI GATC 1 cut(s) 772
BstMAI GTCTC 2 cut(s) 82, 700
BstMBI GATC 1 cut(s) 769
BstMWI GCNNNNNNNGC 1 cut(s) 633
BstNI CCWGG 1 cut(s) 831
BstSCI CCNGG 1 cut(s) 829
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 928
BstV2I GAAGAC 1 cut(s) 295
BsuRI GGCC 2 cut(s) 314, 886
BveI ACCTGC 1 cut(s) 590
Cac8I GCNNGC 1 cut(s) 634
Cfr13I GGNCC 1 cut(s) 313
Csp6I GTAC 2 cut(s) 89, 294
CviAII CATG 2 cut(s) 593, 691
CviJI RGCY 9 cut(s) 151, 314, 357, 399, 477, 656, 726, 886, 919
CviKI_1 RGCY 9 cut(s) 151, 314, 357, 399, 477, 656, 726, 886, 919
CviQI GTAC 2 cut(s) 89, 294
DdeI CTNAG 2 cut(s) 567, 697
DpnI GATC 1 cut(s) 771
DpnII GATC 1 cut(s) 769
DraI TTTAAA 1 cut(s) 9
Eco31I GGTCTC 1 cut(s) 700
EcoRI GAATTC 1 cut(s) 559
EcoRII CCWGG 1 cut(s) 829
FaeI CATG 2 cut(s) 596, 694
FaiI YATR 9 cut(s) 156, 409, 411, 594, 692, 789, 823, 922, 924
FatI CATG 2 cut(s) 592, 690
FauNDI CATATG 2 cut(s) 409, 922
FbaI TGATCA 1 cut(s) 769
Fnu4HI GCNGC 1 cut(s) 917
Fsp4HI GCNGC 1 cut(s) 917
FspBI CTAG 4 cut(s) 17, 428, 657, 675
GluI GCNGC 1 cut(s) 917
GsuI CTGGAG 3 cut(s) 249, 276, 852
HaeIII GGCC 2 cut(s) 314, 886
HapII CCGG 1 cut(s) 887
Hin1II CATG 2 cut(s) 596, 694
HincII GTYRAC 1 cut(s) 343
HindII GTYRAC 1 cut(s) 343
HindIII AAGCTT 2 cut(s) 355, 475
HinfI GANTC 8 cut(s) 75, 233, 242, 404, 524, 731, 764, 812
HpaII CCGG 1 cut(s) 887
HphI GGTGA 4 cut(s) 24, 482, 545, 863
Hpy166II GTNNAC 1 cut(s) 343
Hpy188I TCNGA 5 cut(s) 568, 700, 769, 774, 882
Hpy188III TCNNGA 1 cut(s) 307
Hpy8I GTNNAC 1 cut(s) 343
HpyAV CCTTC 4 cut(s) 304, 410, 485, 530
HpyCH4III ACNGT 2 cut(s) 136, 533
HpyCH4V TGCA 5 cut(s) 194, 217, 592, 599, 751
HpyF10VI GCNNNNNNNGC 1 cut(s) 633
HpyF3I CTNAG 2 cut(s) 567, 697
Hsp92II CATG 2 cut(s) 596, 694
Ksp22I TGATCA 1 cut(s) 769
Kzo9I GATC 1 cut(s) 769
Lsp1109I GCAGC 1 cut(s) 928
MaeI CTAG 4 cut(s) 17, 428, 657, 675
MaeIII GTNAC 2 cut(s) 451, 869
MalI GATC 1 cut(s) 771
MboI GATC 1 cut(s) 769
MboII GAAGA 7 cut(s) 165, 295, 380, 383, 500, 597, 713
MlyI GAGTC 3 cut(s) 84, 251, 758
MmeI TCCRAC 1 cut(s) 406
MnlI CCTC 9 cut(s) 133, 271, 328, 533, 574, 634, 827, 876, 884
MseI TTAA 5 cut(s) 8, 47, 110, 465, 864
MslI CAYNNNNRTG 1 cut(s) 925
MspCI CTTAAG 1 cut(s) 109
MspI CCGG 1 cut(s) 887
MspR9I CCNGG 1 cut(s) 831
MvaI CCWGG 1 cut(s) 831
MwoI GCNNNNNNNGC 1 cut(s) 633
NdeI CATATG 2 cut(s) 409, 922
NdeII GATC 1 cut(s) 769
NlaIII CATG 2 cut(s) 596, 694
NmuCI GTSAC 1 cut(s) 869
PaqCI CACCTGC 1 cut(s) 590
PfeI GAWTC 5 cut(s) 233, 404, 524, 731, 812
PfoI TCCNGGA 1 cut(s) 829
PkrI GCNGC 1 cut(s) 918
PleI GAGTC 3 cut(s) 83, 250, 758
PpsI GAGTC 3 cut(s) 83, 250, 758
PsiI TTATAA 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 829
PspGI CCWGG 1 cut(s) 829
PspPI GGNCC 1 cut(s) 313
RsaI GTAC 2 cut(s) 90, 295
RsaNI GTAC 2 cut(s) 89, 294
RseI CAYNNNNRTG 1 cut(s) 925
SaqAI TTAA 5 cut(s) 8, 47, 110, 465, 864
SatI GCNGC 1 cut(s) 917
Sau3AI GATC 1 cut(s) 769
Sau96I GGNCC 1 cut(s) 313
SchI GAGTC 3 cut(s) 84, 251, 758
ScrFI CCNGG 1 cut(s) 831
SetI ASST 9 cut(s) 133, 359, 401, 472, 479, 604, 658, 838, 876
SfcI CTRYAG 1 cut(s) 132
SmiMI CAYNNNNRTG 1 cut(s) 925
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
SsiI CCGC 1 cut(s) 845
SspI AATATT 1 cut(s) 328
SspMI CTAG 4 cut(s) 17, 428, 657, 675
StyD4I CCNGG 1 cut(s) 829
TaaI ACNGT 2 cut(s) 136, 533
TaqI TCGA 2 cut(s) 264, 502
TatI WGTACW 1 cut(s) 88
TfiI GAWTC 5 cut(s) 233, 404, 524, 731, 812
Tru1I TTAA 5 cut(s) 8, 47, 110, 465, 864
Tru9I TTAA 5 cut(s) 8, 47, 110, 465, 864
TseFI GTSAC 1 cut(s) 869
TseI GCWGC 1 cut(s) 916
Tsp45I GTSAC 1 cut(s) 869
TspDTI ATGAA 1 cut(s) 396
Vha464I CTTAAG 1 cut(s) 109
XapI RAATTY 4 cut(s) 169, 269, 559, 578
XspI CTAG 4 cut(s) 17, 428, 657, 675
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.