Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000312.1

Orthogroup ID

OG0003624

Physical Location & Seq

Genomic Coordinates Reverse (-)

58615 .. 62516

Gene Structure 3902 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000312.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1815 bp

atggttttaaagaaactagagcagtttttctcaccaaaaagaaacttaatttctgggtttgttttgggaattggagtctctctcattgtactttttgtgagcaactccttaaggagtagtagtcctacacctacagtagaggaacaggggctttataatgtttttgtaaattcttcttttgtttcaactactgcacattccattgccccagaattgcagagttctactggagaatcaaatgagtctgtaattgctggagtagtcgaaaaatttgtggaggacaatgagaatggtacaatggtcttccagaaggcccagttgggaaatattacagaggaagttgacgatagaataagcttttgggttgaagaagaaagtgtccaactgaaagatgatagctttgattcatatggggaaggaagtgttctagggattgcccagttggggaatgttacagagcaagttaaaggtgaaagcttaggggttgaagaaggaagtgttcgacaaaaagatggcaactttgattcaaacggtgaaggagggattgcccatttggggaattcctctgagattttggaatttggaagattgcatggtgcaggtgggaaagcaacggggaaatcaagcgttgctggcaaagaggaaagcgttgaagctagtttttcaaacaattctaggagtgggaatggcatggtctcagaagatgtaaaaattgaaattattggctttgattctcaaacttgggaaatgcagagtgatgatgactctgatcagaaatgtgatatttatgatggtaaatgggtaagagatgattcaatgccatactatcctggaggttcttgtccgcacattgatagggattttaattgtcacctcaatcggaggccggacgatgagtttttgaaatggaaatggcagccatatgggtgcgacatctcaagtctgaatgcaactgattttctggagaggttgaggggaaagaggctggtttttgtgggagattcgctgaataggaacatgtgggagtctctggtgtgcattctacgccacagagtccgacagaagaataaagtttatgagctttcaggaaagtcgcaatttaagaagaggggcatttattcattcaagtttgaggaatacaattgttttgtggaatatgttggttcaccattccttgttaggcaatcatcattcgccggtaaagagaccttgaggttggatttgatggaccagaccacatcgaagtatcgtgatgctgatattatagttttcaacaccgcccactggtggaattactggaaaacagctagaggactacactattaccaagaaggcaactatgtgcacccaaggctaaaggctcttgaagcatacaagagagctctcaccacttgggctagatgggtggacatgaacatcaatcccaaccggactcgggttttcttccgaggatatgcatattcccattacagtaatgggcaatggaactcaggaggacattgccacaaagaaacagaaccaatctttaacgaagctcatttatcgaagtatccttcgaaaatgagagctgtagagtctgtacttcaaggaatgaaaactccggtgacgtatttaaacataagtaggcttacagattacagaaaagatgcccacccttccatttacagaatggaatacaagacaaaagaagaagaaattgctgctgaacgatctcaggattgcaaccattggtgcttgccgggggttccggatacttggaacgaattgctatatgcttcgcttttgaaggacggatgggaatcagggcaaaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0008150 GO:0008374 GO:0009987 GO:0012505 GO:0016407 GO:0016413 GO:0016740 GO:0016746 GO:0016747 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0071554

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PC-Esterase PMR5N

Protein Analysis

604

Amino Acids

68.69

Weight (kDa)

5.65

Isoelectric Point (pI)

46.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003624)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G60790
fragaria_vesca	FvH4_4g33000 FvH4_4g33000
malus_domestica	MD13G1095600.v1.1 MD16G1097100.v1.1
prunus_persica	Prupe.1G249700_v2.0.a1 Prupe.1G249700_v2.0.a1 Prupe.1G249700_v2.0.a1 Prupe.1G249700_v2.0.a1 Prupe.1G249700_v2.0.a1 Prupe.1G249700_v2.0.a1
pyrus_communis	pycom13g08330
rosa_chinensis	RchiOBHm_Chr4g0433581 RchiOBHm_Chr4g0433591 RchiOBHm_Chr4g0442021
rosa_laevigata	RLG00000006050 RLG00000006742
rosa_multiflora	Rmu_co8339215.1_g000001 Rmu_sc0000312.1_g000016 Rmu_sc0002501.1_g000017 Rmu_sc0008304.1_g000001
rosa_roxburghii	Rroxscaffold_5G00375070 Rroxscaffold_5G00382910
rosa_rugosa	Rorug04G0269800 Rorug04G0338000
rosa_samantha	Rh4AG324800 Rh4AG389800 Rh4BG332500 Rh4BG403200 Rh4CG347800 Rh4CG418300 Rh4DG329000 Rh4DG396400
rosa_wichuraiana	Rw4G028110 Rw4G033680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	156
AarI	CACCTGC	1 cut(s)	590
Acc36I	ACCTGC	1 cut(s)	590
AccIII	TCCGGA	1 cut(s)	1747
AciI	CCGC	2 cut(s)	845, 1278
AcsI	RAATTY	4 cut(s)	169, 269, 559, 578
AfaI	GTAC	3 cut(s)	90, 295, 1581
AfiI	CCNNNNNNNGG	5 cut(s)	444, 555, 1284, 1287, 1435
AflII	CTTAAG	1 cut(s)	109
AflIII	ACRYGT	1 cut(s)	1017
AjnI	CCWGG	1 cut(s)	829
AjuI	GAANNNNNNNTTGG	4 cut(s)	302, 334, 343, 375
AluBI	AGCT	9 cut(s)	357, 399, 477, 656, 1081, 1307, 1382, 1535, 1568
AluI	AGCT	9 cut(s)	357, 399, 477, 656, 1081, 1307, 1382, 1535, 1568
Alw21I	GWGCWC	2 cut(s)	1347, 1384
Alw26I	GTCTC	4 cut(s)	82, 700, 1032, 1199
Alw44I	GTGCAC	1 cut(s)	1343
Ama87I	CYCGRG	1 cut(s)	1434
Aor13HI	TCCGGA	1 cut(s)	1747
AoxI	GGCC	2 cut(s)	312, 884
ApaLI	GTGCAC	1 cut(s)	1343
ApeKI	GCWGC	2 cut(s)	916, 1700
ApoI	RAATTY	4 cut(s)	169, 269, 559, 578
AspS9I	GGNCC	2 cut(s)	313, 1228
AsuC2I	CCSGG	1 cut(s)	1740
AsuHPI	GGTGA	7 cut(s)	24, 482, 545, 863, 1158, 1378, 1615
AsuII	TTCGAA	1 cut(s)	1556
AvaI	CYCGRG	1 cut(s)	1434
AvaII	GGWCC	1 cut(s)	1228
BaeGI	GKGCMC	1 cut(s)	1347
BaeI	ACNNNNGTAYC	2 cut(s)	285, 318
BanII	GRGCYC	1 cut(s)	1384
BbsI	GAAGAC	1 cut(s)	295
Bbv12I	GWGCWC	2 cut(s)	1347, 1384
BbvI	GCAGC	2 cut(s)	928, 1687
BccI	CCATC	5 cut(s)	506, 785, 1219, 1395, 1788
BciT130I	CCWGG	1 cut(s)	831
BciVI	GTATCC	2 cut(s)	1560, 1744
BclI	TGATCA	1 cut(s)	769
BcnI	CCSGG	1 cut(s)	1740
BcoDI	GTCTC	4 cut(s)	82, 700, 1032, 1199
BfaI	CTAG	6 cut(s)	17, 428, 657, 675, 1308, 1398
BfmI	CTRYAG	2 cut(s)	132, 1569
BfrI	CTTAAG	1 cut(s)	109
BfuAI	ACCTGC	1 cut(s)	590
BfuI	GTATCC	2 cut(s)	1560, 1744
BisI	GCNGC	2 cut(s)	917, 1701
BlsI	GCNGC	2 cut(s)	918, 1702
Bme1390I	CCNGG	2 cut(s)	831, 1740
Bme18I	GGWCC	1 cut(s)	1228
BmeT110I	CYCGRG	1 cut(s)	1434
BmgT120I	GGNCC	2 cut(s)	313, 1228
BmiI	GGNNCC	1 cut(s)	1746
BmrFI	CCNGG	2 cut(s)	831, 1740
BmrI	ACTGGG	2 cut(s)	310, 433
BmsI	GCATC	2 cut(s)	1243, 1636
BmuI	ACTGGG	2 cut(s)	310, 433
BpiI	GAAGAC	1 cut(s)	295
BplI	GAGNNNNNCTC	2 cut(s)	66, 98
BpmI	CTGGAG	4 cut(s)	249, 276, 852, 983
Bpu10I	CCTNAGC	1 cut(s)	478
Bpu14I	TTCGAA	1 cut(s)	1556
BpuEI	CTTGAG	2 cut(s)	922, 1231
BpuMI	CCSGG	1 cut(s)	1740
BsaBI	GATNNNNATC	1 cut(s)	1798
BsaI	GGTCTC	2 cut(s)	700, 1199
BsaJI	CCNNGG	3 cut(s)	1349, 1447, 1739
BsaWI	WCCGGW	3 cut(s)	1428, 1600, 1747
BsaXI	ACNNNNNCTCC	2 cut(s)	106, 136
Bsc4I	CCNNNNNNNGG	5 cut(s)	444, 555, 1284, 1287, 1435
Bse118I	RCCGGY	1 cut(s)	1196
Bse1I	ACTGG	5 cut(s)	232, 316, 439, 1289, 1301
Bse3DI	GCAATG	3 cut(s)	201, 1487, 1498
Bse8I	GATNNNNATC	1 cut(s)	1798
BseAI	TCCGGA	1 cut(s)	1747
BseBI	CCWGG	1 cut(s)	831
BseDI	CCNNGG	3 cut(s)	1349, 1447, 1739
BseGI	GGATG	1 cut(s)	1799
BseJI	GATNNNNATC	1 cut(s)	1798
BseLI	CCNNNNNNNGG	5 cut(s)	444, 555, 1284, 1287, 1435
BseMI	GCAATG	3 cut(s)	201, 1487, 1498
BseMII	CTCAG	4 cut(s)	558, 711, 1503, 1727
BseNI	ACTGG	5 cut(s)	232, 316, 439, 1289, 1301
BseSI	GKGCMC	1 cut(s)	1347
BseXI	GCAGC	2 cut(s)	928, 1687
BsgI	GTGCAG	2 cut(s)	177, 618
BshFI	GGCC	2 cut(s)	314, 886
BsiHKAI	GWGCWC	2 cut(s)	1347, 1384
BsiHKCI	CYCGRG	1 cut(s)	1434
BsiSI	CCGG	6 cut(s)	887, 1197, 1429, 1601, 1739, 1748
BslI	CCNNNNNNNGG	5 cut(s)	444, 555, 1284, 1287, 1435
BsmAI	GTCTC	4 cut(s)	82, 700, 1032, 1199
BsmI	GAATGC	2 cut(s)	952, 1038
BsnI	GGCC	2 cut(s)	314, 886
Bso31I	GGTCTC	2 cut(s)	700, 1199
BsoBI	CYCGRG	1 cut(s)	1434
Bsp119I	TTCGAA	1 cut(s)	1556
Bsp1286I	GDGCHC	2 cut(s)	1347, 1384
Bsp13I	TCCGGA	1 cut(s)	1747
Bsp143I	GATC	2 cut(s)	769, 1709
BspACI	CCGC	2 cut(s)	845, 1278
BspANI	GGCC	2 cut(s)	314, 886
BspCNI	CTCAG	4 cut(s)	559, 710, 1502, 1726
BspEI	TCCGGA	1 cut(s)	1747
BspLI	GGNNCC	1 cut(s)	1746
BspMI	ACCTGC	1 cut(s)	590
BspT104I	TTCGAA	1 cut(s)	1556
BspTI	CTTAAG	1 cut(s)	109
BspTNI	GGTCTC	2 cut(s)	700, 1199
BsrDI	GCAATG	3 cut(s)	201, 1487, 1498
BsrFI	RCCGGY	1 cut(s)	1196
BsrI	ACTGG	5 cut(s)	232, 316, 439, 1289, 1301
BssAI	RCCGGY	1 cut(s)	1196
BssECI	CCNNGG	3 cut(s)	1349, 1447, 1739
BssMI	GATC	2 cut(s)	769, 1709
BssT1I	CCWWGG	1 cut(s)	1349
Bst2UI	CCWGG	1 cut(s)	831
Bst4CI	ACNGT	3 cut(s)	136, 533, 1472
Bst6I	CTCTTC	1 cut(s)	1100
BstAFI	CTTAAG	1 cut(s)	109
BstBI	TTCGAA	1 cut(s)	1556
BstC8I	GCNNGC	2 cut(s)	634, 1736
BstDEI	CTNAG	5 cut(s)	478, 567, 697, 1489, 1713
BstF5I	GGATG	1 cut(s)	1799
BstKTI	GATC	2 cut(s)	772, 1712
BstMAI	GTCTC	4 cut(s)	82, 700, 1032, 1199
BstMBI	GATC	2 cut(s)	769, 1709
BstMWI	GCNNNNNNNGC	4 cut(s)	633, 1044, 1351, 1367
BstNI	CCWGG	1 cut(s)	831
BstNSI	RCATGY	1 cut(s)	1021
BstSCI	CCNGG	2 cut(s)	829, 1738
BstSFI	CTRYAG	2 cut(s)	132, 1569
BstSLI	GKGCMC	1 cut(s)	1347
BstV1I	GCAGC	2 cut(s)	928, 1687
BstV2I	GAAGAC	1 cut(s)	295
BsuI	GTATCC	2 cut(s)	1560, 1744
BsuRI	GGCC	2 cut(s)	314, 886
BtsCI	GGATG	1 cut(s)	1799
BtsIMutI	CAGTG	1 cut(s)	1282
BveI	ACCTGC	1 cut(s)	590
Cac8I	GCNNGC	2 cut(s)	634, 1736
Cfr10I	RCCGGY	1 cut(s)	1196
Cfr13I	GGNCC	2 cut(s)	313, 1228
Csp6I	GTAC	3 cut(s)	89, 294, 1580
CviAII	CATG	4 cut(s)	593, 691, 1018, 1411
CviQI	GTAC	3 cut(s)	89, 294, 1580
DdeI	CTNAG	5 cut(s)	478, 567, 697, 1489, 1713
DpnI	GATC	2 cut(s)	771, 1711
DpnII	GATC	2 cut(s)	769, 1709
DraI	TTTAAA	2 cut(s)	9, 1614
Eam1104I	CTCTTC	1 cut(s)	1100
EarI	CTCTTC	1 cut(s)	1100
Ecl136II	GAGCTC	1 cut(s)	1382
Eco130I	CCWWGG	1 cut(s)	1349
Eco24I	GRGCYC	1 cut(s)	1384
Eco31I	GGTCTC	2 cut(s)	700, 1199
Eco47I	GGWCC	1 cut(s)	1228
Eco53kI	GAGCTC	1 cut(s)	1382
Eco88I	CYCGRG	1 cut(s)	1434
EcoICRI	GAGCTC	1 cut(s)	1382
EcoRI	GAATTC	1 cut(s)	559
EcoRII	CCWGG	1 cut(s)	829
EcoT14I	CCWWGG	1 cut(s)	1349
EcoT22I	ATGCAT	1 cut(s)	1459
EcoT38I	GRGCYC	1 cut(s)	1384
ErhI	CCWWGG	1 cut(s)	1349
FaeI	CATG	4 cut(s)	596, 694, 1021, 1414
FatI	CATG	4 cut(s)	592, 690, 1017, 1410
FauNDI	CATATG	2 cut(s)	409, 922
FbaI	TGATCA	1 cut(s)	769
Fnu4HI	GCNGC	2 cut(s)	917, 1701
FokI	GGATG	1 cut(s)	1806
FriOI	GRGCYC	1 cut(s)	1384
Fsp4HI	GCNGC	2 cut(s)	917, 1701
FspBI	CTAG	6 cut(s)	17, 428, 657, 675, 1308, 1398
GluI	GCNGC	2 cut(s)	917, 1701
GsuI	CTGGAG	4 cut(s)	249, 276, 852, 983
HaeIII	GGCC	2 cut(s)	314, 886
HapII	CCGG	6 cut(s)	887, 1197, 1429, 1601, 1739, 1748
Hin1II	CATG	4 cut(s)	596, 694, 1021, 1414
HincII	GTYRAC	1 cut(s)	343
HindII	GTYRAC	1 cut(s)	343
HindIII	AAGCTT	2 cut(s)	355, 475
HpaII	CCGG	6 cut(s)	887, 1197, 1429, 1601, 1739, 1748
HphI	GGTGA	7 cut(s)	24, 482, 545, 863, 1158, 1378, 1615
Hpy166II	GTNNAC	4 cut(s)	343, 1166, 1345, 1408
Hpy188I	TCNGA	8 cut(s)	568, 700, 769, 774, 882, 945, 1058, 1448
Hpy188III	TCNNGA	8 cut(s)	307, 962, 1086, 1250, 1364, 1491, 1715, 1748
Hpy8I	GTNNAC	4 cut(s)	343, 1166, 1345, 1408
HpyAV	CCTTC	8 cut(s)	304, 410, 485, 530, 1325, 1563, 1665, 1780
HpyCH4III	ACNGT	3 cut(s)	136, 533, 1472
HpyCH4IV	ACGT	1 cut(s)	1607
HpyF10VI	GCNNNNNNNGC	4 cut(s)	633, 1044, 1351, 1367
HpyF3I	CTNAG	5 cut(s)	478, 567, 697, 1489, 1713
HpySE526I	ACGT	1 cut(s)	1607
Hsp92II	CATG	4 cut(s)	596, 694, 1021, 1414
Kpn2I	TCCGGA	1 cut(s)	1747
Ksp22I	TGATCA	1 cut(s)	769
Kzo9I	GATC	2 cut(s)	769, 1709
Lsp1109I	GCAGC	2 cut(s)	928, 1687
LweI	GCATC	2 cut(s)	1243, 1636
MaeI	CTAG	6 cut(s)	17, 428, 657, 675, 1308, 1398
MaeII	ACGT	1 cut(s)	1607
MaeIII	GTNAC	3 cut(s)	451, 869, 1603
MalI	GATC	2 cut(s)	771, 1711
MboI	GATC	2 cut(s)	769, 1709
MfeI	CAATTG	1 cut(s)	1141
MhlI	GDGCHC	2 cut(s)	1347, 1384
MlyI	GAGTC	7 cut(s)	84, 251, 758, 1034, 1062, 1426, 1583
MmeI	TCCRAC	3 cut(s)	406, 1081, 1197
Mph1103I	ATGCAT	1 cut(s)	1459
MroI	TCCGGA	1 cut(s)	1747
MseI	TTAA	8 cut(s)	8, 47, 110, 465, 864, 1101, 1527, 1613
MslI	CAYNNNNRTG	1 cut(s)	925
MspCI	CTTAAG	1 cut(s)	109
MspI	CCGG	6 cut(s)	887, 1197, 1429, 1601, 1739, 1748
MspR9I	CCNGG	2 cut(s)	831, 1740
MunI	CAATTG	1 cut(s)	1141
Mva1269I	GAATGC	2 cut(s)	952, 1038
MvaI	CCWGG	1 cut(s)	831
MwoI	GCNNNNNNNGC	4 cut(s)	633, 1044, 1351, 1367
NciI	CCSGG	1 cut(s)	1740
NdeI	CATATG	2 cut(s)	409, 922
NdeII	GATC	2 cut(s)	769, 1709
NlaIII	CATG	4 cut(s)	596, 694, 1021, 1414
NlaIV	GGNNCC	1 cut(s)	1746
NmuCI	GTSAC	2 cut(s)	869, 1603
NsiI	ATGCAT	1 cut(s)	1459
NspI	RCATGY	1 cut(s)	1021
NspV	TTCGAA	1 cut(s)	1556
PaqCI	CACCTGC	1 cut(s)	590
PciI	ACATGT	1 cut(s)	1017
PctI	GAATGC	2 cut(s)	952, 1038
PfeI	GAWTC	7 cut(s)	233, 404, 524, 731, 812, 1001, 1799
PfoI	TCCNGGA	1 cut(s)	829
PkrI	GCNGC	2 cut(s)	918, 1702
PleI	GAGTC	7 cut(s)	83, 250, 758, 1033, 1061, 1426, 1582
PpsI	GAGTC	7 cut(s)	83, 250, 758, 1033, 1061, 1426, 1582
PscI	ACATGT	1 cut(s)	1017
PsiI	TTATAA	1 cut(s)	156
Psp124BI	GAGCTC	1 cut(s)	1384
Psp6I	CCWGG	1 cut(s)	829
PspGI	CCWGG	1 cut(s)	829
PspN4I	GGNNCC	1 cut(s)	1746
PspPI	GGNCC	2 cut(s)	313, 1228
RsaI	GTAC	3 cut(s)	90, 295, 1581
RsaNI	GTAC	3 cut(s)	89, 294, 1580
RseI	CAYNNNNRTG	1 cut(s)	925
SacI	GAGCTC	1 cut(s)	1384
SaqAI	TTAA	8 cut(s)	8, 47, 110, 465, 864, 1101, 1527, 1613
SatI	GCNGC	2 cut(s)	917, 1701
Sau3AI	GATC	2 cut(s)	769, 1709
Sau96I	GGNCC	2 cut(s)	313, 1228
SchI	GAGTC	7 cut(s)	84, 251, 758, 1034, 1062, 1426, 1583
ScrFI	CCNGG	2 cut(s)	831, 1740
SduI	GDGCHC	2 cut(s)	1347, 1384
SfaNI	GCATC	2 cut(s)	1243, 1636
SfcI	CTRYAG	2 cut(s)	132, 1569
SfuI	TTCGAA	1 cut(s)	1556
SinI	GGWCC	1 cut(s)	1228
SmiMI	CAYNNNNRTG	1 cut(s)	925
SmlI	CTYRAG	3 cut(s)	109, 937, 1210
SmoI	CTYRAG	3 cut(s)	109, 937, 1210
SsiI	CCGC	2 cut(s)	845, 1278
SspI	AATATT	1 cut(s)	328
SspMI	CTAG	6 cut(s)	17, 428, 657, 675, 1308, 1398
SstI	GAGCTC	1 cut(s)	1384
StyD4I	CCNGG	2 cut(s)	829, 1738
StyI	CCWWGG	1 cut(s)	1349
TaaI	ACNGT	3 cut(s)	136, 533, 1472
TaiI	ACGT	1 cut(s)	1610
TaqI	TCGA	5 cut(s)	264, 502, 1241, 1544, 1556
TatI	WGTACW	2 cut(s)	88, 1579
TfiI	GAWTC	7 cut(s)	233, 404, 524, 731, 812, 1001, 1799
Tru1I	TTAA	8 cut(s)	8, 47, 110, 465, 864, 1101, 1527, 1613
Tru9I	TTAA	8 cut(s)	8, 47, 110, 465, 864, 1101, 1527, 1613
TscAI	CASTG	1 cut(s)	1289
TseFI	GTSAC	2 cut(s)	869, 1603
TseI	GCWGC	2 cut(s)	916, 1700
Tsp45I	GTSAC	2 cut(s)	869, 1603
TspDTI	ATGAA	4 cut(s)	396, 1110, 1427, 1607
TspGWI	ACGGA	1 cut(s)	1806
TspRI	CASTG	1 cut(s)	1289
Vha464I	CTTAAG	1 cut(s)	109
VneI	GTGCAC	1 cut(s)	1343
VpaK11BI	GGWCC	1 cut(s)	1228
XapI	RAATTY	4 cut(s)	169, 269, 559, 578
XceI	RCATGY	1 cut(s)	1021
XcmI	CCANNNNNNNNNTGG	2 cut(s)	1472, 1666
XspI	CTAG	6 cut(s)	17, 428, 657, 675, 1308, 1398
Zsp2I	ATGCAT	1 cut(s)	1459

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.