Rmu_co8349609.1_g000001

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8349609.1
Physical Location & Seq
Forward (+)
1 .. 628
628 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8349609.1_g000001.1.cds

Sequence Viewer

Length: 157 bp
ggaatgcatcgacaagtcaatgcgaatggggaacaatgagtgccctgcttgccgcacacactgtgccagtcgacggtctttgagagatgatccaaattatgatgccataattgcaacattatatccagatattgagaaatatgagaaggaggtataa

Protein Analysis

51

Amino Acids

5.92

Weight (kDa)

5.18

Isoelectric Point (pI)

78.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 71
AciI CCGC 1 cut(s) 53
AclWI GGATC 1 cut(s) 84
AdeI CACNNNGTG 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 73
AlwI GGATC 1 cut(s) 84
BaeGI GKGCMC 1 cut(s) 45
BisI GCNGC 1 cut(s) 53
BlsI GCNGC 1 cut(s) 54
BmsI GCATC 2 cut(s) 16, 92
Bsc4I CCNNNNNNNGG 1 cut(s) 73
Bse1I ACTGG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 73
BseNI ACTGG 1 cut(s) 67
BseSI GKGCMC 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 73
BsmI GAATGC 1 cut(s) 9
Bsp1286I GDGCHC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 89
BspACI CCGC 1 cut(s) 53
BspPI GGATC 1 cut(s) 84
BsrI ACTGG 1 cut(s) 67
BssMI GATC 1 cut(s) 89
Bst4CI ACNGT 2 cut(s) 63, 76
BstC8I GCNNGC 1 cut(s) 50
BstKTI GATC 1 cut(s) 92
BstMBI GATC 1 cut(s) 89
BstMWI GCNNNNNNNGC 2 cut(s) 49, 111
BstSLI GKGCMC 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 59
Cac8I GCNNGC 1 cut(s) 50
DpnI GATC 1 cut(s) 91
DpnII GATC 1 cut(s) 89
DraIII CACNNNGTG 1 cut(s) 63
EcoT22I ATGCAT 1 cut(s) 9
FaiI YATR 5 cut(s) 100, 108, 122, 142, 155
FblI GTMKAC 1 cut(s) 71
Fnu4HI GCNGC 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 53
GluI GCNGC 1 cut(s) 53
HincII GTYRAC 1 cut(s) 72
HindII GTYRAC 1 cut(s) 72
Hpy166II GTNNAC 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 126
Hpy8I GTNNAC 1 cut(s) 72
Hpy99I CGWCG 1 cut(s) 76
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 2 cut(s) 63, 76
HpyCH4V TGCA 2 cut(s) 7, 114
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 111
Kzo9I GATC 1 cut(s) 89
LpnPI CCDG 3 cut(s) 58, 80, 139
LweI GCATC 2 cut(s) 16, 92
MalI GATC 1 cut(s) 91
MboI GATC 1 cut(s) 89
MhlI GDGCHC 1 cut(s) 45
MluCI AATT 2 cut(s) 95, 109
MnlI CCTC 1 cut(s) 143
Mph1103I ATGCAT 1 cut(s) 9
Mva1269I GAATGC 1 cut(s) 9
MwoI GCNNNNNNNGC 2 cut(s) 49, 111
NdeII GATC 1 cut(s) 89
NsiI ATGCAT 1 cut(s) 9
PctI GAATGC 1 cut(s) 9
PkrI GCNGC 1 cut(s) 54
SalI GTCGAC 1 cut(s) 70
SatI GCNGC 1 cut(s) 53
Sau3AI GATC 1 cut(s) 89
SduI GDGCHC 1 cut(s) 45
SetI ASST 1 cut(s) 154
SfaNI GCATC 2 cut(s) 16, 92
SgeI CNNG 5 cut(s) 26, 57, 61, 79, 138
Sse9I AATT 2 cut(s) 95, 109
SsiI CCGC 1 cut(s) 53
TaaI ACNGT 2 cut(s) 63, 76
TaqI TCGA 2 cut(s) 10, 71
TasI AATT 2 cut(s) 95, 109
TauI GCSGC 1 cut(s) 55
TscAI CASTG 1 cut(s) 66
TspRI CASTG 1 cut(s) 66
XmiI GTMKAC 1 cut(s) 71
Zsp2I ATGCAT 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.