Rmu_co8437141.1_g000001
MYB Family

PHD zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8437141.1
OG0001342
Physical Location & Seq
Forward (+)
84 .. 938
855 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8437141.1_g000001.1.cds

Sequence Viewer

Length: 855 bp
atggattttctttgtgagtcagagacatcaaatgaaagtgatggttttcatgataaaaagattgatgctgccatgaagaagcatgctttcttgagatctcaatgcacgtctagtcatgattccttagtgacaacagtcatagagaaaaatcgttccctgtaccgtaatgaaggtggtcaattattgacttgtaaaacaagtaattgccctgcggtggttcatgagaactggctacgttcctcagccatttcttttgagaagggtaacttttattgccccttctgttcatatgctcatgcccttactgattaccttgaagctaggaaacaaacttccctgttaaagacaggcctaaatgcatttgttcatgctaatttggaaaaccgtccgatggaacctgttggaagagtccatagcaaagtgaataattgctctagacattttgagtataattttcttgggaaaccttatcagaataggcatctagaagagcgtgaagaaaatcagggaaatcaatgtgaagaacatgtaaatgaagttgatgatgtccagtttcacaatattatttatgataagcaacaaggaccaccttcttcatcatgcactgaaatcaagtctatgcgtggaaaagttcatgtaccagctggtgagaaagaaggggaagaaaaggtagtttctgagtgtgtgtcagcaggccttgatagatttcagaaccaagtactggaaggtgatcatttgtccagtaaaaacacacagagcctccttgttgaccaaggacaagctgatgcagtagaagtcgtgcagcagcacattattgattactccttaagaaaaaggagcaaatctccttggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_6 Myb_DNA-binding

Protein Analysis

284

Amino Acids

32.24

Weight (kDa)

6.06

Isoelectric Point (pI)

48.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 721
AciI CCGC 1 cut(s) 212
AfaI GTAC 3 cut(s) 161, 639, 720
AfiI CCNNNNNNNGG 3 cut(s) 214, 391, 721
AflII CTTAAG 1 cut(s) 826
AflIII ACRYGT 1 cut(s) 526
AgsI TTSAA 1 cut(s) 317
AjiI CACGTC 1 cut(s) 108
AluBI AGCT 3 cut(s) 320, 644, 782
AluI AGCT 3 cut(s) 320, 644, 782
Alw26I GTCTC 1 cut(s) 17
AoxI GGCC 2 cut(s) 349, 694
ApeKI GCWGC 3 cut(s) 68, 802, 805
AspS9I GGNCC 1 cut(s) 584
AsuHPI GGTGA 2 cut(s) 659, 740
AvaII GGWCC 1 cut(s) 584
BbvCI CCTCAGC 1 cut(s) 241
BbvI GCAGC 3 cut(s) 55, 814, 817
BccI CCATC 2 cut(s) 35, 385
BclI TGATCA 1 cut(s) 730
BcoDI GTCTC 1 cut(s) 17
BfaI CTAG 4 cut(s) 111, 321, 435, 485
BfrI CTTAAG 1 cut(s) 826
BglII AGATCT 1 cut(s) 95
BisI GCNGC 3 cut(s) 69, 803, 806
BlsI GCNGC 3 cut(s) 70, 804, 807
BmcAI AGTACT 1 cut(s) 720
Bme18I GGWCC 1 cut(s) 584
BmgBI CACGTC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 584
BmiI GGNNCC 1 cut(s) 396
BmsI GCATC 3 cut(s) 55, 490, 775
BoxI GACNNNNGTC 1 cut(s) 134
BplI GAGNNNNNCTC 1 cut(s) 829
Bpu10I CCTNAGC 1 cut(s) 241
BpuEI CTTGAG 1 cut(s) 112
BsaJI CCNNGG 2 cut(s) 772, 848
BsaXI ACNNNNNCTCC 2 cut(s) 744, 774
Bsc4I CCNNNNNNNGG 3 cut(s) 214, 391, 721
Bse1I ACTGG 4 cut(s) 233, 550, 726, 741
BseDI CCNNGG 2 cut(s) 772, 848
BseLI CCNNNNNNNGG 3 cut(s) 214, 391, 721
BseMII CTCAG 2 cut(s) 255, 669
BseNI ACTGG 4 cut(s) 233, 550, 726, 741
BseXI GCAGC 3 cut(s) 55, 814, 817
BsgI GTGCAG 1 cut(s) 821
BshFI GGCC 2 cut(s) 351, 696
BslI CCNNNNNNNGG 3 cut(s) 214, 391, 721
BsmAI GTCTC 1 cut(s) 17
BsnI GGCC 2 cut(s) 351, 696
Bsp143I GATC 2 cut(s) 95, 730
BspACI CCGC 1 cut(s) 212
BspANI GGCC 2 cut(s) 351, 696
BspCNI CTCAG 2 cut(s) 254, 670
BspHI TCATGA 3 cut(s) 49, 115, 220
BspLI GGNNCC 1 cut(s) 396
BspQI GCTCTTC 1 cut(s) 483
BspTI CTTAAG 1 cut(s) 826
BsrI ACTGG 4 cut(s) 233, 550, 726, 741
BssECI CCNNGG 2 cut(s) 772, 848
BssMI GATC 2 cut(s) 95, 730
BssT1I CCWWGG 2 cut(s) 772, 848
Bst4CI ACNGT 3 cut(s) 136, 164, 386
Bst6I CTCTTC 2 cut(s) 400, 483
BstAFI CTTAAG 1 cut(s) 826
BstC8I GCNNGC 2 cut(s) 84, 694
BstDEI CTNAG 3 cut(s) 124, 241, 678
BstKTI GATC 2 cut(s) 98, 733
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 2 cut(s) 95, 730
BstNSI RCATGY 2 cut(s) 86, 530
BstPAI GACNNNNGTC 1 cut(s) 134
BstV1I GCAGC 3 cut(s) 55, 814, 817
BstX2I RGATCY 1 cut(s) 95
BstYI RGATCY 1 cut(s) 95
BsuRI GGCC 2 cut(s) 351, 696
BtrI CACGTC 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 603
Cac8I GCNNGC 2 cut(s) 84, 694
CciI TCATGA 3 cut(s) 49, 115, 220
Cfr13I GGNCC 1 cut(s) 584
Csp6I GTAC 3 cut(s) 160, 638, 719
CviJI RGCY 8 cut(s) 232, 245, 320, 351, 644, 696, 759, 782
CviKI_1 RGCY 8 cut(s) 232, 245, 320, 351, 644, 696, 759, 782
CviQI GTAC 3 cut(s) 160, 638, 719
DdeI CTNAG 3 cut(s) 124, 241, 678
DpnI GATC 2 cut(s) 97, 732
DpnII GATC 2 cut(s) 95, 730
Eam1104I CTCTTC 2 cut(s) 400, 483
EarI CTCTTC 2 cut(s) 400, 483
Eco130I CCWWGG 2 cut(s) 772, 848
Eco147I AGGCCT 2 cut(s) 351, 696
Eco47I GGWCC 1 cut(s) 584
EcoT14I CCWWGG 2 cut(s) 772, 848
EcoT22I ATGCAT 1 cut(s) 361
ErhI CCWWGG 2 cut(s) 772, 848
FalI AAGNNNNNCTT 2 cut(s) 251, 283
FauNDI CATATG 1 cut(s) 289
FbaI TGATCA 1 cut(s) 730
Fnu4HI GCNGC 3 cut(s) 69, 803, 806
Fsp4HI GCNGC 3 cut(s) 69, 803, 806
FspBI CTAG 4 cut(s) 111, 321, 435, 485
GluI GCNGC 3 cut(s) 69, 803, 806
HaeIII GGCC 2 cut(s) 351, 696
HincII GTYRAC 1 cut(s) 769
HindII GTYRAC 1 cut(s) 769
HinfI GANTC 3 cut(s) 17, 119, 408
HphI GGTGA 2 cut(s) 659, 740
Hpy166II GTNNAC 1 cut(s) 769
Hpy188I TCNGA 5 cut(s) 22, 390, 474, 679, 711
Hpy188III TCNNGA 6 cut(s) 50, 91, 116, 221, 435, 485
Hpy8I GTNNAC 1 cut(s) 769
HpyAV CCTTC 6 cut(s) 164, 253, 289, 600, 650, 719
HpyCH4III ACNGT 3 cut(s) 136, 164, 386
HpyCH4IV ACGT 2 cut(s) 107, 235
HpyCH4V TGCA 5 cut(s) 105, 359, 603, 788, 802
HpyF3I CTNAG 3 cut(s) 124, 241, 678
HpySE526I ACGT 2 cut(s) 107, 235
Ksp22I TGATCA 1 cut(s) 730
Kzo9I GATC 2 cut(s) 95, 730
LguI GCTCTTC 1 cut(s) 483
LmnI GCTCC 1 cut(s) 837
Lsp1109I GCAGC 3 cut(s) 55, 814, 817
LweI GCATC 3 cut(s) 55, 490, 775
MaeI CTAG 4 cut(s) 111, 321, 435, 485
MaeII ACGT 2 cut(s) 107, 235
MaeIII GTNAC 2 cut(s) 127, 263
MalI GATC 2 cut(s) 97, 732
MboI GATC 2 cut(s) 95, 730
MboII GAAGA 7 cut(s) 88, 417, 500, 509, 533, 585, 674
MflI RGATCY 1 cut(s) 95
MluCI AATT 5 cut(s) 179, 202, 373, 427, 451
MlyI GAGTC 2 cut(s) 26, 417
MmeI TCCRAC 1 cut(s) 382
MnlI CCTC 2 cut(s) 250, 770
Mph1103I ATGCAT 1 cut(s) 361
MseI TTAA 2 cut(s) 341, 827
MslI CAYNNNNRTG 1 cut(s) 531
MspA1I CMGCKG 1 cut(s) 644
MspCI CTTAAG 1 cut(s) 826
NdeI CATATG 1 cut(s) 289
NdeII GATC 2 cut(s) 95, 730
NlaIV GGNNCC 1 cut(s) 396
NmuCI GTSAC 1 cut(s) 127
NsiI ATGCAT 1 cut(s) 361
NspI RCATGY 2 cut(s) 86, 530
PaeI GCATGC 1 cut(s) 86
PagI TCATGA 3 cut(s) 49, 115, 220
PceI AGGCCT 2 cut(s) 351, 696
PciI ACATGT 1 cut(s) 526
PciSI GCTCTTC 1 cut(s) 483
PfeI GAWTC 1 cut(s) 119
PflMI CCANNNNNTGG 1 cut(s) 721
PkrI GCNGC 3 cut(s) 70, 804, 807
PleI GAGTC 2 cut(s) 25, 416
PpsI GAGTC 2 cut(s) 25, 416
PscI ACATGT 1 cut(s) 526
PshAI GACNNNNGTC 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 396
PspPI GGNCC 1 cut(s) 584
PsuI RGATCY 1 cut(s) 95
PvuII CAGCTG 1 cut(s) 644
RsaI GTAC 3 cut(s) 161, 639, 720
RsaNI GTAC 3 cut(s) 160, 638, 719
RseI CAYNNNNRTG 1 cut(s) 531
SapI GCTCTTC 1 cut(s) 483
SaqAI TTAA 2 cut(s) 341, 827
SatI GCNGC 3 cut(s) 69, 803, 806
Sau3AI GATC 2 cut(s) 95, 730
Sau96I GGNCC 1 cut(s) 584
ScaI AGTACT 1 cut(s) 720
SchI GAGTC 2 cut(s) 26, 417
SfaNI GCATC 3 cut(s) 55, 490, 775
SinI GGWCC 1 cut(s) 584
SmiMI CAYNNNNRTG 1 cut(s) 531
SmlI CTYRAG 2 cut(s) 91, 826
SmoI CTYRAG 2 cut(s) 91, 826
SphI GCATGC 1 cut(s) 86
Sse9I AATT 5 cut(s) 179, 202, 373, 427, 451
SseBI AGGCCT 2 cut(s) 351, 696
SsiI CCGC 1 cut(s) 212
SspI AATATT 1 cut(s) 562
SspMI CTAG 4 cut(s) 111, 321, 435, 485
StuI AGGCCT 2 cut(s) 351, 696
StyI CCWWGG 2 cut(s) 772, 848
TaaI ACNGT 3 cut(s) 136, 164, 386
TaiI ACGT 2 cut(s) 110, 238
TasI AATT 5 cut(s) 179, 202, 373, 427, 451
TatI WGTACW 1 cut(s) 718
TfiI GAWTC 1 cut(s) 119
Tru1I TTAA 2 cut(s) 341, 827
Tru9I TTAA 2 cut(s) 341, 827
TscAI CASTG 1 cut(s) 610
TseFI GTSAC 1 cut(s) 127
TseI GCWGC 3 cut(s) 68, 802, 805
Tsp45I GTSAC 1 cut(s) 127
TspRI CASTG 1 cut(s) 610
Van91I CCANNNNNTGG 1 cut(s) 721
Vha464I CTTAAG 1 cut(s) 826
VpaK11BI GGWCC 1 cut(s) 584
XbaI TCTAGA 2 cut(s) 434, 484
XceI RCATGY 2 cut(s) 86, 530
XspI CTAG 4 cut(s) 111, 321, 435, 485
ZrmI AGTACT 1 cut(s) 720
Zsp2I ATGCAT 1 cut(s) 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.