Rorug03G0190800
MYB Family

PHD zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0001342
Physical Location & Seq
Reverse (-)
16723249 .. 16723467
219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0190800.1

Sequence Viewer

Length: 219 bp
ATGAACGCCGAGTTGACTCTGGTCCGGAACGACATCGAGGACTTGAGCACGTCGCGGATGGAGCTCGCGACCGAGTTGAAGACGATCCAAGGAGAGATTGAGAGGGCTCACTCCGACGAGTCTAAGCAAATCGAAGCCATTAGAGACGAAATTGAGACTTTGAAGCTGGAGATTGAGAAAGGAATAAAATTGAGACTCCAGTTGGGGTTTCGTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_6 Myb_DNA-binding

Protein Analysis

72

Amino Acids

8.36

Weight (kDa)

4.84

Isoelectric Point (pI)

60.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 55, 68
AccIII TCCGGA 1 cut(s) 24
AciI CCGC 1 cut(s) 55
AclWI GGATC 1 cut(s) 79
AgsI TTSAA 2 cut(s) 79, 163
AjiI CACGTC 1 cut(s) 51
AluBI AGCT 2 cut(s) 64, 166
AluI AGCT 2 cut(s) 64, 166
Alw21I GWGCWC 2 cut(s) 50, 66
Alw26I GTCTC 3 cut(s) 138, 149, 187
AlwI GGATC 1 cut(s) 79
Aor13HI TCCGGA 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 22
AvaII GGWCC 1 cut(s) 22
BanII GRGCYC 2 cut(s) 66, 109
BbsI GAAGAC 1 cut(s) 86
Bbv12I GWGCWC 2 cut(s) 50, 66
BccI CCATC 1 cut(s) 52
BcoDI GTCTC 3 cut(s) 138, 149, 187
BfaI CTAG 1 cut(s) 217
Bme18I GGWCC 1 cut(s) 22
BmgBI CACGTC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 22
BoxI GACNNNNGTC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 2 cut(s) 182, 188
BpuEI CTTGAG 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 88
BsaWI WCCGGW 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 199
BseAI TCCGGA 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 199
Bsh1236I CGCG 2 cut(s) 55, 68
Bsh1285I CGRYCG 1 cut(s) 72
BsiEI CGRYCG 1 cut(s) 72
BsiHKAI GWGCWC 2 cut(s) 50, 66
BsiSI CCGG 1 cut(s) 25
BsmAI GTCTC 3 cut(s) 138, 149, 187
BsmBI CGTCTC 1 cut(s) 138
Bsp1286I GDGCHC 3 cut(s) 50, 66, 109
Bsp13I TCCGGA 1 cut(s) 24
Bsp143I GATC 1 cut(s) 84
Bsp68I TCGCGA 1 cut(s) 68
BspACI CCGC 1 cut(s) 55
BspEI TCCGGA 1 cut(s) 24
BspFNI CGCG 2 cut(s) 55, 68
BspPI GGATC 1 cut(s) 79
BsrI ACTGG 1 cut(s) 199
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 1 cut(s) 84
BssT1I CCWWGG 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 1 cut(s) 63
BstFNI CGCG 2 cut(s) 55, 68
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 3 cut(s) 138, 149, 187
BstMBI GATC 1 cut(s) 84
BstMCI CGRYCG 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstPAI GACNNNNGTC 1 cut(s) 20
BstUI CGCG 2 cut(s) 55, 68
BstV2I GAAGAC 1 cut(s) 86
BtrI CACGTC 1 cut(s) 51
BtsCI GGATG 1 cut(s) 63
BtuMI TCGCGA 1 cut(s) 68
Cac8I GCNNGC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 22
CviJI RGCY 4 cut(s) 64, 107, 137, 166
CviKI_1 RGCY 4 cut(s) 64, 107, 137, 166
DdeI CTNAG 1 cut(s) 123
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Ecl136II GAGCTC 1 cut(s) 64
Eco130I CCWWGG 1 cut(s) 88
Eco24I GRGCYC 2 cut(s) 66, 109
Eco47I GGWCC 1 cut(s) 22
Eco53kI GAGCTC 1 cut(s) 64
EcoICRI GAGCTC 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 88
EcoT38I GRGCYC 2 cut(s) 66, 109
ErhI CCWWGG 1 cut(s) 88
Esp3I CGTCTC 1 cut(s) 138
FokI GGATG 1 cut(s) 70
FriOI GRGCYC 2 cut(s) 66, 109
FspBI CTAG 1 cut(s) 217
GsuI CTGGAG 2 cut(s) 182, 188
HapII CCGG 1 cut(s) 25
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HinfI GANTC 3 cut(s) 16, 119, 195
HpaII CCGG 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 25, 67
Hpy8I GTNNAC 1 cut(s) 15
Hpy99I CGWCG 2 cut(s) 55, 119
HpyCH4IV ACGT 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
HpyF3I CTNAG 1 cut(s) 123
HpySE526I ACGT 1 cut(s) 50
Kpn2I TCCGGA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 4 cut(s) 5, 38, 152, 212
MaeI CTAG 1 cut(s) 217
MaeII ACGT 1 cut(s) 50
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 91
MhlI GDGCHC 3 cut(s) 50, 66, 109
MluCI AATT 2 cut(s) 150, 188
MlyI GAGTC 3 cut(s) 10, 128, 189
MmeI TCCRAC 1 cut(s) 138
MnlI CCTC 2 cut(s) 31, 96
MroI TCCGGA 1 cut(s) 24
MspI CCGG 1 cut(s) 25
MvnI CGCG 2 cut(s) 55, 68
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 1 cut(s) 84
NmeAIII GCCGAG 1 cut(s) 34
NruI TCGCGA 1 cut(s) 68
PleI GAGTC 3 cut(s) 10, 127, 189
PpsI GAGTC 3 cut(s) 10, 127, 189
PshAI GACNNNNGTC 1 cut(s) 20
Psp124BI GAGCTC 1 cut(s) 66
PspPI GGNCC 1 cut(s) 22
RruI TCGCGA 1 cut(s) 68
SacI GAGCTC 1 cut(s) 66
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 22
SchI GAGTC 3 cut(s) 10, 128, 189
SduI GDGCHC 3 cut(s) 50, 66, 109
SetI ASST 3 cut(s) 53, 66, 168
SinI GGWCC 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 2 cut(s) 150, 188
SsiI CCGC 1 cut(s) 55
SspMI CTAG 1 cut(s) 217
SstI GAGCTC 1 cut(s) 66
StyI CCWWGG 1 cut(s) 88
TaiI ACGT 1 cut(s) 53
TaqI TCGA 2 cut(s) 36, 132
TaqII GACCGA 1 cut(s) 86
TasI AATT 2 cut(s) 150, 188
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 22
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.