Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8443917.1

Orthogroup ID

OG0005909

Physical Location & Seq

Genomic Coordinates Forward (+)

551 .. 1621

Gene Structure 1071 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8443917.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 725 bp

atggctgaagaaaagagcaagatactgataattggaagcacaggccatctaggccggtacatggtgaaggcaagcgtttctttgggacatccaacctatgcttatgtgcgaccaatcaaacccaccaccgattcttcaaagcttcagttgctcaaggaatttgaagccatggggctcactcttcttcaaggtgaactggatgatcatgaaaatctagtggggacacttaaactagttgacattgtcatttctactttggctgttcctcaacatcttgaacagctcaaaataatcaaggctatcaaagaagctgggaatataaagagattctttccgtcagaattcggaaacgaagaagatagagtaagtgggctgccacctttcgaggctatacatgtgaatagaaggaagattagaagggctacagaagcagcaggaatttcatacacttatgtgtctgcaaacactattgcttcttactttgttgactatttacttcatcctcatgagaaacgggaggaagtaatcgtgtatggcagtggtgaagccaaggccgtgttaaactacgaggaagatgtagccgcttacaccataagagcagcaacagatccaagagcagcgaaccggatcgtgatttgtagaccgcaaggaaacattgtatctcaattggagttgatatcagcatgggagaaaaagacaggacgcactcttaaaaggatccatgt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NmrA

Protein Analysis

242

Amino Acids

27.02

Weight (kDa)

8.81

Isoelectric Point (pI)

35.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005909)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28640 FvH4_3g28660
malus_domestica	MD03G1173300.v1.1 MD11G1191100.v1.1
prunus_persica	Prupe.4G251700_v2.0.a1 Prupe.4G251900_v2.0.a1 Prupe.4G252000_v2.0.a1 Prupe.4G252300_v2.0.a1
pyrus_communis	pycom03g13040 pycom03g13060 pycom11g17360
rosa_chinensis	RchiOBHm_Chr5g0052411 RchiOBHm_Chr5g0052441
rosa_laevigata	RLG00000034818
rosa_multiflora	Rmu_co8443917.1_g000001 Rmu_sc0006803.1_g000047 Rmu_sc0011203.1_g000019
rosa_roxburghii	Rroxscaffold_1G00028310 Rroxscaffold_1G00028340
rosa_rugosa	Rorug05G0271900 Rorug05G0272000 Rorug05G0272100
rosa_samantha	Rh5AG344700 Rh5AG344800 Rh5BG355600 Rh5CG381300
rosa_wichuraiana	Rw5G032530 Rw5G032540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	640
AciI	CCGC	2 cut(s)	582, 644
AclWI	GGATC	3 cut(s)	602, 635, 712
AcsI	RAATTY	3 cut(s)	158, 341, 438
AcuI	CTGAAG	2 cut(s)	27, 128
AfaI	GTAC	1 cut(s)	59
AfiI	CCNNNNNNNGG	1 cut(s)	61
AflIII	ACRYGT	1 cut(s)	394
AgsI	TTSAA	4 cut(s)	138, 164, 188, 278
AhlI	ACTAGT	1 cut(s)	232
AleI	CACNNNNGTG	1 cut(s)	452
AluBI	AGCT	3 cut(s)	142, 283, 311
AluI	AGCT	3 cut(s)	142, 283, 311
AlwI	GGATC	3 cut(s)	602, 635, 712
AoxI	GGCC	3 cut(s)	43, 52, 552
ApeKI	GCWGC	4 cut(s)	373, 431, 599, 617
ApoI	RAATTY	3 cut(s)	158, 341, 438
AsuHPI	GGTGA	3 cut(s)	76, 203, 554
BamHI	GGATCC	1 cut(s)	717
BanII	GRGCYC	1 cut(s)	177
BbvI	GCAGC	4 cut(s)	360, 443, 611, 629
BccI	CCATC	1 cut(s)	54
BceAI	ACGGC	1 cut(s)	539
BclI	TGATCA	1 cut(s)	202
BcuI	ACTAGT	1 cut(s)	232
BfaI	CTAG	3 cut(s)	50, 215, 233
BfmI	CTRYAG	1 cut(s)	423
BglI	GCCNNNNNGGC	1 cut(s)	51
BisI	GCNGC	5 cut(s)	374, 432, 582, 600, 618
BlsI	GCNGC	5 cut(s)	375, 433, 583, 601, 619
BmiI	GGNNCC	1 cut(s)	719
BpuEI	CTTGAG	1 cut(s)	137
BsaJI	CCNNGG	2 cut(s)	168, 549
BsaWI	WCCGGW	1 cut(s)	624
Bsc4I	CCNNNNNNNGG	1 cut(s)	61
Bse118I	RCCGGY	1 cut(s)	54
Bse1I	ACTGG	1 cut(s)	201
BseDI	CCNNGG	2 cut(s)	168, 549
BseGI	GGATG	3 cut(s)	88, 205, 499
BseLI	CCNNNNNNNGG	1 cut(s)	61
BseNI	ACTGG	1 cut(s)	201
BseXI	GCAGC	4 cut(s)	360, 443, 611, 629
BseYI	CCCAGC	1 cut(s)	311
BshFI	GGCC	3 cut(s)	45, 54, 554
BsiSI	CCGG	2 cut(s)	55, 625
BslFI	GGGAC	2 cut(s)	99, 235
BslI	CCNNNNNNNGG	1 cut(s)	61
BsmFI	GGGAC	2 cut(s)	99, 235
BsnI	GGCC	3 cut(s)	45, 54, 554
Bsp1286I	GDGCHC	1 cut(s)	177
Bsp143I	GATC	4 cut(s)	202, 607, 627, 717
Bsp19I	CCATGG	1 cut(s)	168
BspACI	CCGC	2 cut(s)	582, 644
BspANI	GGCC	3 cut(s)	45, 54, 554
BspHI	TCATGA	2 cut(s)	205, 505
BspLI	GGNNCC	1 cut(s)	719
BspPI	GGATC	3 cut(s)	602, 635, 712
BsrFI	RCCGGY	1 cut(s)	54
BsrI	ACTGG	1 cut(s)	201
BssAI	RCCGGY	1 cut(s)	54
BssECI	CCNNGG	2 cut(s)	168, 549
BssMI	GATC	4 cut(s)	202, 607, 627, 717
BssT1I	CCWWGG	2 cut(s)	168, 549
Bst6I	CTCTTC	1 cut(s)	186
BstC8I	GCNNGC	1 cut(s)	73
BstDSI	CCRYGG	1 cut(s)	168
BstF5I	GGATG	3 cut(s)	88, 205, 499
BstKTI	GATC	4 cut(s)	205, 610, 630, 720
BstMBI	GATC	4 cut(s)	202, 607, 627, 717
BstMWI	GCNNNNNNNGC	3 cut(s)	51, 148, 428
BstNSI	RCATGY	1 cut(s)	398
BstSFI	CTRYAG	1 cut(s)	423
BstV1I	GCAGC	4 cut(s)	360, 443, 611, 629
BstX2I	RGATCY	2 cut(s)	607, 717
BstYI	RGATCY	2 cut(s)	607, 717
BsuRI	GGCC	3 cut(s)	45, 54, 554
BtgI	CCRYGG	1 cut(s)	168
BtsCI	GGATG	3 cut(s)	88, 205, 499
BtsI	GCAGTG	1 cut(s)	544
BtsIMutI	CAGTG	1 cut(s)	544
Cac8I	GCNNGC	1 cut(s)	73
CciI	TCATGA	2 cut(s)	205, 505
Cfr10I	RCCGGY	1 cut(s)	54
CseI	GACGC	1 cut(s)	711
Csp6I	GTAC	1 cut(s)	58
CviAII	CATG	7 cut(s)	61, 169, 206, 395, 506, 684, 722
CviQI	GTAC	1 cut(s)	58
DpnI	GATC	4 cut(s)	204, 609, 629, 719
DpnII	GATC	4 cut(s)	202, 607, 627, 717
Eam1104I	CTCTTC	1 cut(s)	186
EarI	CTCTTC	1 cut(s)	186
Eco130I	CCWWGG	2 cut(s)	168, 549
Eco24I	GRGCYC	1 cut(s)	177
Eco32I	GATATC	1 cut(s)	678
Eco57I	CTGAAG	2 cut(s)	27, 128
EcoRI	GAATTC	1 cut(s)	341
EcoRV	GATATC	1 cut(s)	678
EcoT14I	CCWWGG	2 cut(s)	168, 549
EcoT38I	GRGCYC	1 cut(s)	177
ErhI	CCWWGG	2 cut(s)	168, 549
FaeI	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
FalI	AAGNNNNNCTT	4 cut(s)	64, 96, 314, 346
FaqI	GGGAC	2 cut(s)	99, 235
FatI	CATG	7 cut(s)	60, 168, 205, 394, 505, 683, 721
FbaI	TGATCA	1 cut(s)	202
FblI	GTMKAC	1 cut(s)	640
Fnu4HI	GCNGC	5 cut(s)	374, 432, 582, 600, 618
FokI	GGATG	3 cut(s)	75, 212, 486
FriOI	GRGCYC	1 cut(s)	177
Fsp4HI	GCNGC	5 cut(s)	374, 432, 582, 600, 618
FspBI	CTAG	3 cut(s)	50, 215, 233
GluI	GCNGC	5 cut(s)	374, 432, 582, 600, 618
GsaI	CCCAGC	1 cut(s)	315
HaeIII	GGCC	3 cut(s)	45, 54, 554
HapII	CCGG	2 cut(s)	55, 625
HgaI	GACGC	1 cut(s)	711
Hin1II	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
HincII	GTYRAC	2 cut(s)	238, 487
HindII	GTYRAC	2 cut(s)	238, 487
HindIII	AAGCTT	1 cut(s)	140
HinfI	GANTC	2 cut(s)	131, 327
HpaII	CCGG	2 cut(s)	55, 625
HphI	GGTGA	3 cut(s)	76, 203, 554
Hpy166II	GTNNAC	4 cut(s)	194, 238, 487, 641
Hpy188I	TCNGA	2 cut(s)	340, 347
Hpy188III	TCNNGA	4 cut(s)	206, 275, 506, 631
Hpy8I	GTNNAC	4 cut(s)	194, 238, 487, 641
HpyAV	CCTTC	3 cut(s)	61, 399, 411
HpyCH4V	TGCA	1 cut(s)	461
HpyF10VI	GCNNNNNNNGC	3 cut(s)	51, 148, 428
Hsp92II	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
Ksp22I	TGATCA	1 cut(s)	202
Kzo9I	GATC	4 cut(s)	202, 607, 627, 717
LpnPI	CCDG	7 cut(s)	27, 68, 182, 297, 420, 638, 684
Lsp1109I	GCAGC	4 cut(s)	360, 443, 611, 629
MaeI	CTAG	3 cut(s)	50, 215, 233
MalI	GATC	4 cut(s)	204, 609, 629, 719
MboI	GATC	4 cut(s)	202, 607, 627, 717
MboII	GAAGA	8 cut(s)	20, 126, 173, 176, 365, 368, 421, 584
MfeI	CAATTG	1 cut(s)	665
MflI	RGATCY	2 cut(s)	607, 717
MhlI	GDGCHC	1 cut(s)	177
MluCI	AATT	5 cut(s)	30, 158, 341, 438, 665
MmeI	TCCRAC	1 cut(s)	116
MnlI	CCTC	5 cut(s)	276, 379, 511, 513, 562
MseI	TTAA	3 cut(s)	228, 560, 711
MslI	CAYNNNNRTG	2 cut(s)	452, 504
MspI	CCGG	2 cut(s)	55, 625
MunI	CAATTG	1 cut(s)	665
MwoI	GCNNNNNNNGC	3 cut(s)	51, 148, 428
NcoI	CCATGG	1 cut(s)	168
NdeII	GATC	4 cut(s)	202, 607, 627, 717
NlaIII	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
NlaIV	GGNNCC	1 cut(s)	719
NspI	RCATGY	1 cut(s)	398
OliI	CACNNNNGTG	1 cut(s)	452
PagI	TCATGA	2 cut(s)	205, 505
PciI	ACATGT	1 cut(s)	394
PfeI	GAWTC	2 cut(s)	131, 327
PflFI	GACNNNGTC	1 cut(s)	242
PkrI	GCNGC	5 cut(s)	375, 433, 583, 601, 619
PscI	ACATGT	1 cut(s)	394
PspFI	CCCAGC	1 cut(s)	311
PspN4I	GGNNCC	1 cut(s)	719
PsuI	RGATCY	2 cut(s)	607, 717
PsyI	GACNNNGTC	1 cut(s)	242
RsaI	GTAC	1 cut(s)	59
RsaNI	GTAC	1 cut(s)	58
RseI	CAYNNNNRTG	2 cut(s)	452, 504
SaqAI	TTAA	3 cut(s)	228, 560, 711
SatI	GCNGC	5 cut(s)	374, 432, 582, 600, 618
Sau3AI	GATC	4 cut(s)	202, 607, 627, 717
SduI	GDGCHC	1 cut(s)	177
SetI	ASST	6 cut(s)	98, 144, 193, 285, 313, 382
SfcI	CTRYAG	1 cut(s)	423
SfiI	GGCCNNNNNGGCC	1 cut(s)	51
SmiMI	CAYNNNNRTG	2 cut(s)	452, 504
SmlI	CTYRAG	1 cut(s)	152
SmoI	CTYRAG	1 cut(s)	152
SpeI	ACTAGT	1 cut(s)	232
Sse9I	AATT	5 cut(s)	30, 158, 341, 438, 665
SsiI	CCGC	2 cut(s)	582, 644
SspMI	CTAG	3 cut(s)	50, 215, 233
StyI	CCWWGG	2 cut(s)	168, 549
TaqI	TCGA	1 cut(s)	384
TasI	AATT	5 cut(s)	30, 158, 341, 438, 665
TauI	GCSGC	1 cut(s)	584
TfiI	GAWTC	2 cut(s)	131, 327
Tru1I	TTAA	3 cut(s)	228, 560, 711
Tru9I	TTAA	3 cut(s)	228, 560, 711
TscAI	CASTG	1 cut(s)	544
TseI	GCWGC	4 cut(s)	373, 431, 599, 617
TspDTI	ATGAA	3 cut(s)	222, 432, 488
TspGWI	ACGGA	1 cut(s)	324
TspRI	CASTG	1 cut(s)	544
Tth111I	GACNNNGTC	1 cut(s)	242
XapI	RAATTY	3 cut(s)	158, 341, 438
XceI	RCATGY	1 cut(s)	398
XmiI	GTMKAC	1 cut(s)	640
XspI	CTAG	3 cut(s)	50, 215, 233

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.