Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011203.1

Orthogroup ID

OG0005909

Physical Location & Seq

Genomic Coordinates Forward (+)

48891 .. 51411

Gene Structure 2521 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011203.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 954 bp

atggctggagaaaagagcaagatactgataattggaagcacaggtcatcttggccagtacatggtgaaggcaagtgtttctttgggacatccaacctatgcttatgtgcgaccaatcaaacccaccaccgattcttcaaagcttcagttgcacaaagagtttgaagccatgggactcactctttttgaaggtgaactggatgatcatgaaaagctagtgcgggcacttaaactagttgacattgtaatttctactttggctattcctcaacatcttgaacagctcaaaattatcaaggctatcaaagaagcaggaaatataaagagattctttccttcagaattcggatttgaagcagatagagcaagtgggctgccacctttggaggcaatacatgtgaatagaaggaagattagaagggcgacagaagcagcaggaatttcctacacttacgtgtctgcaaacacttttgcttcttactttgttgattatttacttcatcctcatgagaaacgcgaggaagtaattgtttatggcagtggtgaagcaaaggccgtgttaaactacgaggaagatgtggctgtttacaccataagagcagcaacagatccgagggcagccaaccggattgtgatttgtagaccgcaaggaaacattgtatctcagttggagttgatatcagcatgggagaaaaagacagcacgcactcttaaaaggatccatgtcccagaacaagaaattatagagctctctaagaccctccctcacccagacaacgtacgtgcatcgatccttcacagcatattcatcaagggggaacagatgaactttgaactcacagacaacgacctcgaggcctccaagttatatctcgattacaagtacacttccattgatagctaccttgacatttgcttggttgatcctcccaggatcaaattagcagcgttgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NmrA

Protein Analysis

317

Amino Acids

35.66

Weight (kDa)

6.84

Isoelectric Point (pI)

30.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005909)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28640 FvH4_3g28660
malus_domestica	MD03G1173300.v1.1 MD11G1191100.v1.1
prunus_persica	Prupe.4G251700_v2.0.a1 Prupe.4G251900_v2.0.a1 Prupe.4G252000_v2.0.a1 Prupe.4G252300_v2.0.a1
pyrus_communis	pycom03g13040 pycom03g13060 pycom11g17360
rosa_chinensis	RchiOBHm_Chr5g0052411 RchiOBHm_Chr5g0052441
rosa_laevigata	RLG00000034818
rosa_multiflora	Rmu_co8443917.1_g000001 Rmu_sc0006803.1_g000047 Rmu_sc0011203.1_g000019
rosa_roxburghii	Rroxscaffold_1G00028310 Rroxscaffold_1G00028340
rosa_rugosa	Rorug05G0271900 Rorug05G0272000 Rorug05G0272100
rosa_samantha	Rh5AG344700 Rh5AG344800 Rh5BG355600 Rh5CG381300
rosa_wichuraiana	Rw5G032530 Rw5G032540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AbsI	CCTCGAGG	1 cut(s)	851
AccB7I	CCANNNNNTGG	1 cut(s)	61
AccI	GTMKAC	1 cut(s)	640
AccII	CGCG	1 cut(s)	516
AciI	CCGC	2 cut(s)	220, 644
AclWI	GGATC	6 cut(s)	602, 712, 725, 784, 917, 941
AcoI	YGGCCR	1 cut(s)	52
AcsI	RAATTY	2 cut(s)	341, 438
AcuI	CTGAAG	2 cut(s)	128, 321
AfaI	GTAC	3 cut(s)	59, 780, 884
AfiI	CCNNNNNNNGG	1 cut(s)	61
AflIII	ACRYGT	2 cut(s)	394, 453
AgsI	TTSAA	6 cut(s)	138, 164, 188, 278, 353, 833
AhlI	ACTAGT	1 cut(s)	232
AjnI	CCWGG	1 cut(s)	929
AleI	CACNNNNGTG	1 cut(s)	452
AluBI	AGCT	5 cut(s)	142, 214, 283, 748, 900
AluI	AGCT	5 cut(s)	142, 214, 283, 748, 900
Alw21I	GWGCWC	1 cut(s)	750
AlwI	GGATC	6 cut(s)	602, 712, 725, 784, 917, 941
Ama87I	CYCGRG	1 cut(s)	851
AoxI	GGCC	3 cut(s)	52, 552, 855
ApeKI	GCWGC	5 cut(s)	373, 431, 599, 617, 944
ApoI	RAATTY	2 cut(s)	341, 438
AsuHPI	GGTGA	4 cut(s)	76, 203, 554, 758
AvaI	CYCGRG	1 cut(s)	851
BaeGI	GKGCMC	1 cut(s)	226
BalI	TGGCCA	1 cut(s)	54
BamHI	GGATCC	1 cut(s)	717
BanII	GRGCYC	1 cut(s)	750
Bbv12I	GWGCWC	1 cut(s)	750
BbvI	GCAGC	4 cut(s)	360, 443, 611, 629
BceAI	ACGGC	1 cut(s)	539
BciT130I	CCWGG	1 cut(s)	931
BclI	TGATCA	1 cut(s)	202
BcuI	ACTAGT	1 cut(s)	232
BfaI	CTAG	2 cut(s)	215, 233
BisI	GCNGC	5 cut(s)	374, 432, 600, 618, 945
BlsI	GCNGC	5 cut(s)	375, 433, 601, 619, 946
Bme1390I	CCNGG	1 cut(s)	931
BmeT110I	CYCGRG	1 cut(s)	851
BmiI	GGNNCC	1 cut(s)	719
BmrFI	CCNGG	1 cut(s)	931
BmsI	GCATC	1 cut(s)	794
BpmI	CTGGAG	1 cut(s)	27
Bsa29I	ATCGAT	1 cut(s)	788
BsaAI	YACGTR	2 cut(s)	454, 782
BsaJI	CCNNGG	3 cut(s)	168, 611, 929
BsaWI	WCCGGW	1 cut(s)	624
Bsc4I	CCNNNNNNNGG	1 cut(s)	61
Bse1I	ACTGG	2 cut(s)	55, 201
BseBI	CCWGG	1 cut(s)	931
BseCI	ATCGAT	1 cut(s)	788
BseDI	CCNNGG	3 cut(s)	168, 611, 929
BseGI	GGATG	3 cut(s)	88, 205, 499
BseLI	CCNNNNNNNGG	1 cut(s)	61
BseMII	CTCAG	1 cut(s)	677
BseNI	ACTGG	2 cut(s)	55, 201
BseSI	GKGCMC	1 cut(s)	226
BseXI	GCAGC	4 cut(s)	360, 443, 611, 629
Bsh1236I	CGCG	1 cut(s)	516
BshFI	GGCC	3 cut(s)	54, 554, 857
BshVI	ATCGAT	1 cut(s)	788
BsiHKAI	GWGCWC	1 cut(s)	750
BsiHKCI	CYCGRG	1 cut(s)	851
BsiSI	CCGG	1 cut(s)	625
BsiWI	CGTACG	1 cut(s)	778
BslFI	GGGAC	3 cut(s)	99, 186, 710
BslI	CCNNNNNNNGG	1 cut(s)	61
BsmFI	GGGAC	3 cut(s)	99, 186, 710
BsnI	GGCC	3 cut(s)	54, 554, 857
BsoBI	CYCGRG	1 cut(s)	851
Bsp1286I	GDGCHC	2 cut(s)	226, 750
Bsp143I	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
Bsp19I	CCATGG	1 cut(s)	168
BspACI	CCGC	2 cut(s)	220, 644
BspANI	GGCC	3 cut(s)	54, 554, 857
BspCNI	CTCAG	1 cut(s)	676
BspDI	ATCGAT	1 cut(s)	788
BspFNI	CGCG	1 cut(s)	516
BspHI	TCATGA	2 cut(s)	205, 505
BspLI	GGNNCC	1 cut(s)	719
BspPI	GGATC	6 cut(s)	602, 712, 725, 784, 917, 941
BsrI	ACTGG	2 cut(s)	55, 201
BssECI	CCNNGG	3 cut(s)	168, 611, 929
BssMI	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
BssT1I	CCWWGG	1 cut(s)	168
Bst2UI	CCWGG	1 cut(s)	931
BstBAI	YACGTR	2 cut(s)	454, 782
BstC8I	GCNNGC	2 cut(s)	222, 703
BstDEI	CTNAG	2 cut(s)	663, 753
BstDSI	CCRYGG	1 cut(s)	168
BstF5I	GGATG	3 cut(s)	88, 205, 499
BstFNI	CGCG	1 cut(s)	516
BstKTI	GATC	6 cut(s)	205, 610, 720, 792, 925, 936
BstMBI	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
BstMWI	GCNNNNNNNGC	3 cut(s)	148, 362, 428
BstNI	CCWGG	1 cut(s)	931
BstNSI	RCATGY	1 cut(s)	398
BstSCI	CCNGG	1 cut(s)	929
BstSLI	GKGCMC	1 cut(s)	226
BstUI	CGCG	1 cut(s)	516
BstV1I	GCAGC	4 cut(s)	360, 443, 611, 629
BstX2I	RGATCY	2 cut(s)	607, 717
BstYI	RGATCY	2 cut(s)	607, 717
Bsu15I	ATCGAT	1 cut(s)	788
BsuRI	GGCC	3 cut(s)	54, 554, 857
BsuTUI	ATCGAT	1 cut(s)	788
BtgI	CCRYGG	1 cut(s)	168
BtsCI	GGATG	3 cut(s)	88, 205, 499
BtsI	GCAGTG	1 cut(s)	544
BtsIMutI	CAGTG	1 cut(s)	544
Cac8I	GCNNGC	2 cut(s)	222, 703
CciI	TCATGA	2 cut(s)	205, 505
ClaI	ATCGAT	1 cut(s)	788
Csp6I	GTAC	3 cut(s)	58, 779, 883
CviAII	CATG	7 cut(s)	61, 169, 206, 395, 506, 684, 722
CviQI	GTAC	3 cut(s)	58, 779, 883
DdeI	CTNAG	2 cut(s)	663, 753
DpnI	GATC	6 cut(s)	204, 609, 719, 791, 924, 935
DpnII	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
EaeI	YGGCCR	1 cut(s)	52
Ecl136II	GAGCTC	1 cut(s)	748
Eco130I	CCWWGG	1 cut(s)	168
Eco147I	AGGCCT	1 cut(s)	857
Eco24I	GRGCYC	1 cut(s)	750
Eco32I	GATATC	1 cut(s)	678
Eco53kI	GAGCTC	1 cut(s)	748
Eco57I	CTGAAG	2 cut(s)	128, 321
Eco88I	CYCGRG	1 cut(s)	851
EcoICRI	GAGCTC	1 cut(s)	748
EcoRI	GAATTC	1 cut(s)	341
EcoRII	CCWGG	1 cut(s)	929
EcoRV	GATATC	1 cut(s)	678
EcoT14I	CCWWGG	1 cut(s)	168
EcoT38I	GRGCYC	1 cut(s)	750
ErhI	CCWWGG	1 cut(s)	168
FaeI	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
FalI	AAGNNNNNCTT	4 cut(s)	64, 96, 314, 346
FaqI	GGGAC	3 cut(s)	99, 186, 710
FatI	CATG	7 cut(s)	60, 168, 205, 394, 505, 683, 721
FauI	CCCGC	1 cut(s)	213
FbaI	TGATCA	1 cut(s)	202
FblI	GTMKAC	1 cut(s)	640
Fnu4HI	GCNGC	5 cut(s)	374, 432, 600, 618, 945
FokI	GGATG	3 cut(s)	75, 212, 486
FriOI	GRGCYC	1 cut(s)	750
Fsp4HI	GCNGC	5 cut(s)	374, 432, 600, 618, 945
FspBI	CTAG	2 cut(s)	215, 233
GluI	GCNGC	5 cut(s)	374, 432, 600, 618, 945
GsuI	CTGGAG	1 cut(s)	27
HaeIII	GGCC	3 cut(s)	54, 554, 857
HapII	CCGG	1 cut(s)	625
Hin1II	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
HincII	GTYRAC	1 cut(s)	238
HindII	GTYRAC	1 cut(s)	238
HindIII	AAGCTT	1 cut(s)	140
HinfI	GANTC	3 cut(s)	131, 174, 327
HpaII	CCGG	1 cut(s)	625
HphI	GGTGA	4 cut(s)	76, 203, 554, 758
Hpy166II	GTNNAC	5 cut(s)	194, 238, 586, 641, 885
Hpy188I	TCNGA	3 cut(s)	340, 347, 612
Hpy188III	TCNNGA	4 cut(s)	206, 275, 506, 872
Hpy8I	GTNNAC	5 cut(s)	194, 238, 586, 641, 885
HpyAV	CCTTC	6 cut(s)	61, 182, 345, 399, 411, 803
HpyCH4IV	ACGT	3 cut(s)	453, 777, 781
HpyCH4V	TGCA	3 cut(s)	151, 461, 785
HpyF10VI	GCNNNNNNNGC	3 cut(s)	148, 362, 428
HpyF3I	CTNAG	2 cut(s)	663, 753
HpySE526I	ACGT	3 cut(s)	453, 777, 781
Hsp92II	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
Ksp22I	TGATCA	1 cut(s)	202
Kzo9I	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
Lsp1109I	GCAGC	4 cut(s)	360, 443, 611, 629
LweI	GCATC	1 cut(s)	794
MaeI	CTAG	2 cut(s)	215, 233
MaeII	ACGT	3 cut(s)	453, 777, 781
MalI	GATC	6 cut(s)	204, 609, 719, 791, 924, 935
MboI	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
MboII	GAAGA	3 cut(s)	126, 421, 584
MflI	RGATCY	2 cut(s)	607, 717
MhlI	GDGCHC	2 cut(s)	226, 750
MlsI	TGGCCA	1 cut(s)	54
MluCI	AATT	8 cut(s)	30, 246, 288, 341, 438, 525, 738, 938
MluNI	TGGCCA	1 cut(s)	54
MlyI	GAGTC	1 cut(s)	168
MmeI	TCCRAC	2 cut(s)	116, 648
Mox20I	TGGCCA	1 cut(s)	54
MscI	TGGCCA	1 cut(s)	54
MseI	TTAA	3 cut(s)	228, 560, 711
MslI	CAYNNNNRTG	2 cut(s)	452, 504
Msp20I	TGGCCA	1 cut(s)	54
MspI	CCGG	1 cut(s)	625
MspR9I	CCNGG	1 cut(s)	931
MvaI	CCWGG	1 cut(s)	931
MvnI	CGCG	1 cut(s)	516
MwoI	GCNNNNNNNGC	3 cut(s)	148, 362, 428
NcoI	CCATGG	1 cut(s)	168
NdeII	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
NlaIII	CATG	7 cut(s)	64, 172, 209, 398, 509, 687, 725
NlaIV	GGNNCC	1 cut(s)	719
NspI	RCATGY	1 cut(s)	398
OliI	CACNNNNGTG	1 cut(s)	452
PaeR7I	CTCGAG	1 cut(s)	851
PagI	TCATGA	2 cut(s)	205, 505
PceI	AGGCCT	1 cut(s)	857
PciI	ACATGT	1 cut(s)	394
PfeI	GAWTC	2 cut(s)	131, 327
Pfl23II	CGTACG	1 cut(s)	778
PflMI	CCANNNNNTGG	1 cut(s)	61
PkrI	GCNGC	5 cut(s)	375, 433, 601, 619, 946
PleI	GAGTC	1 cut(s)	168
PpsI	GAGTC	1 cut(s)	168
Ppu21I	YACGTR	2 cut(s)	454, 782
PscI	ACATGT	1 cut(s)	394
Psp124BI	GAGCTC	1 cut(s)	750
Psp6I	CCWGG	1 cut(s)	929
PspGI	CCWGG	1 cut(s)	929
PspLI	CGTACG	1 cut(s)	778
PspN4I	GGNNCC	1 cut(s)	719
PspXI	VCTCGAGB	1 cut(s)	851
PsuI	RGATCY	2 cut(s)	607, 717
RsaI	GTAC	3 cut(s)	59, 780, 884
RsaNI	GTAC	3 cut(s)	58, 779, 883
RseI	CAYNNNNRTG	2 cut(s)	452, 504
SacI	GAGCTC	1 cut(s)	750
SaqAI	TTAA	3 cut(s)	228, 560, 711
SatI	GCNGC	5 cut(s)	374, 432, 600, 618, 945
Sau3AI	GATC	6 cut(s)	202, 607, 717, 789, 922, 933
SchI	GAGTC	1 cut(s)	168
ScrFI	CCNGG	1 cut(s)	931
SduI	GDGCHC	2 cut(s)	226, 750
SfaNI	GCATC	1 cut(s)	794
Sfr274I	CTCGAG	1 cut(s)	851
SlaI	CTCGAG	1 cut(s)	851
SmiMI	CAYNNNNRTG	2 cut(s)	452, 504
SmlI	CTYRAG	1 cut(s)	851
SmoI	CTYRAG	1 cut(s)	851
SpeI	ACTAGT	1 cut(s)	232
Sse9I	AATT	8 cut(s)	30, 246, 288, 341, 438, 525, 738, 938
SseBI	AGGCCT	1 cut(s)	857
SsiI	CCGC	2 cut(s)	220, 644
SspMI	CTAG	2 cut(s)	215, 233
SstI	GAGCTC	1 cut(s)	750
StuI	AGGCCT	1 cut(s)	857
StyD4I	CCNGG	1 cut(s)	929
StyI	CCWWGG	1 cut(s)	168
TaiI	ACGT	3 cut(s)	456, 780, 784
TaqI	TCGA	3 cut(s)	788, 852, 873
TasI	AATT	8 cut(s)	30, 246, 288, 341, 438, 525, 738, 938
TatI	WGTACW	2 cut(s)	57, 882
TfiI	GAWTC	2 cut(s)	131, 327
Tru1I	TTAA	3 cut(s)	228, 560, 711
Tru9I	TTAA	3 cut(s)	228, 560, 711
TscAI	CASTG	1 cut(s)	544
TseI	GCWGC	5 cut(s)	373, 431, 599, 617, 944
TspDTI	ATGAA	4 cut(s)	222, 488, 796, 839
TspRI	CASTG	1 cut(s)	544
Van91I	CCANNNNNTGG	1 cut(s)	61
XapI	RAATTY	2 cut(s)	341, 438
XceI	RCATGY	1 cut(s)	398
XhoI	CTCGAG	1 cut(s)	851
XmiI	GTMKAC	1 cut(s)	640
XspI	CTAG	2 cut(s)	215, 233

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.