Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8477279.1

Orthogroup ID

OG0004110

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 2007

Gene Structure 2007 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8477279.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 570 bp

atgaacgacgccgtttactccgagtatgacctagctctgcacgtcaaggaagttctcgtttcgttctcatctggagatgttgaatcttctgaaaactaccggaacctggttgcgatttttaacatgagcctgtggaactatgggccggaggtgatggatgcattggttgaattgatcattgctttggccacttcaagtgggaagtatcttgatatatgcttggagatgctcgtatccaatttcgtgtctcatgatccttatatgctggaaaagttgaagatgccacatggtcttaaaaagaaggatcaagttttaactcgtgtccacagagctctgaaagttatctctgatttgtcacctctttcccctagaaatttgctgatactagtttaccgtggtctaaatggatattataccagaaaaggaactagtactcttgctcttgagttatgcgtagagaacatgctaaagttggagagcgttggaaattggatcattgaagaattctcacaagatcatggactatttcagatggagctggaacatctttatctgaatgatggtagtgag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RRN3

Protein Analysis

190

Amino Acids

21.61

Weight (kDa)

5.03

Isoelectric Point (pI)

30.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004110)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30590 AT1G30590 AT1G30590 AT2G34750 AT2G39240 AT2G39240
fragaria_vesca	FvH4_1g10010 FvH4_1g10010
malus_domestica	MD02G1108900.v1.1
prunus_persica	Prupe.7G186400_v2.0.a1 Prupe.7G186400_v2.0.a1
pyrus_communis	pycom02g08740 pycom15g20300
rosa_chinensis	RchiOBHm_Chr2g0096801 RchiOBHm_Chr2g0096841
rosa_laevigata	RLG00000016671 RLG00000016673
rosa_multiflora	Rmu_co8477279.1_g000001 Rmu_ssc0000215.1_g000029
rosa_roxburghii	Rroxscaffold_2G00145270 Rroxscaffold_2G00145300
rosa_rugosa	Rorug02G0061000 Rorug02G0061300
rosa_samantha	Rh2AG108400 Rh2AG108800 Rh2BG110500 Rh2BG110800 Rh2CG112400 Rh2CG112900 Rh2DG111800 Rh2DG112100
rosa_wichuraiana	Rw2G008380 Rw2G008420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	248, 312, 500
AcoI	YGGCCR	1 cut(s)	186
AcsI	RAATTY	2 cut(s)	373, 503
AcyI	GRCGYC	1 cut(s)	9
AfaI	GTAC	1 cut(s)	433
AfiI	CCNNNNNNNGG	1 cut(s)	106
AgsI	TTSAA	5 cut(s)	83, 170, 195, 277, 500
AhlI	ACTAGT	2 cut(s)	385, 428
AjiI	CACGTC	1 cut(s)	43
AjnI	CCWGG	1 cut(s)	105
AluBI	AGCT	3 cut(s)	35, 332, 538
AluI	AGCT	3 cut(s)	35, 332, 538
Alw21I	GWGCWC	1 cut(s)	334
Alw26I	GTCTC	1 cut(s)	252
AlwI	GGATC	3 cut(s)	248, 312, 500
AoxI	GGCC	2 cut(s)	143, 186
ApoI	RAATTY	2 cut(s)	373, 503
AspS9I	GGNCC	1 cut(s)	143
AsuHPI	GGTGA	2 cut(s)	163, 348
BalI	TGGCCA	1 cut(s)	188
BanII	GRGCYC	1 cut(s)	334
BauI	CACGAG	1 cut(s)	318
Bbv12I	GWGCWC	1 cut(s)	334
BccI	CCATC	3 cut(s)	148, 526, 554
BciT130I	CCWGG	1 cut(s)	107
BciVI	GTATCC	1 cut(s)	244
BclI	TGATCA	1 cut(s)	174
BcoDI	GTCTC	1 cut(s)	252
BcuI	ACTAGT	2 cut(s)	385, 428
BfaI	CTAG	4 cut(s)	32, 369, 386, 429
BfuI	GTATCC	1 cut(s)	244
BmcAI	AGTACT	1 cut(s)	433
Bme1390I	CCNGG	1 cut(s)	107
BmgBI	CACGTC	1 cut(s)	43
BmgT120I	GGNCC	1 cut(s)	143
BmiI	GGNNCC	1 cut(s)	104
BmrFI	CCNGG	1 cut(s)	107
BmsI	GCATC	3 cut(s)	148, 216, 270
BpmI	CTGGAG	1 cut(s)	93
BpuEI	CTTGAG	1 cut(s)	464
BsaHI	GRCGYC	1 cut(s)	9
BsaJI	CCNNGG	1 cut(s)	394
BsaWI	WCCGGW	1 cut(s)	99
Bsc4I	CCNNNNNNNGG	1 cut(s)	106
Bse3DI	GCAATG	1 cut(s)	177
BseBI	CCWGG	1 cut(s)	107
BseDI	CCNNGG	1 cut(s)	394
BseGI	GGATG	1 cut(s)	163
BseLI	CCNNNNNNNGG	1 cut(s)	106
BseMI	GCAATG	1 cut(s)	177
BsgI	GTGCAG	1 cut(s)	23
BshFI	GGCC	2 cut(s)	145, 188
BsiHKAI	GWGCWC	1 cut(s)	334
BsiSI	CCGG	2 cut(s)	100, 146
BslI	CCNNNNNNNGG	1 cut(s)	106
BsmAI	GTCTC	1 cut(s)	252
BsnI	GGCC	2 cut(s)	145, 188
Bsp1286I	GDGCHC	1 cut(s)	334
Bsp143I	GATC	5 cut(s)	174, 253, 304, 492, 514
BspANI	GGCC	2 cut(s)	145, 188
BspHI	TCATGA	1 cut(s)	250
BspLI	GGNNCC	1 cut(s)	104
BspPI	GGATC	3 cut(s)	248, 312, 500
BsrDI	GCAATG	1 cut(s)	177
BssECI	CCNNGG	1 cut(s)	394
BssMI	GATC	5 cut(s)	174, 253, 304, 492, 514
BssNI	GRCGYC	1 cut(s)	9
BssSI	CACGAG	1 cut(s)	318
Bst2BI	CACGAG	1 cut(s)	318
Bst2UI	CCWGG	1 cut(s)	107
Bst4CI	ACNGT	1 cut(s)	395
BstACI	GRCGYC	1 cut(s)	9
BstDSI	CCRYGG	1 cut(s)	394
BstF5I	GGATG	1 cut(s)	163
BstKTI	GATC	5 cut(s)	177, 256, 307, 495, 517
BstMAI	GTCTC	1 cut(s)	252
BstMBI	GATC	5 cut(s)	174, 253, 304, 492, 514
BstNI	CCWGG	1 cut(s)	107
BstNSI	RCATGY	1 cut(s)	466
BstSCI	CCNGG	1 cut(s)	105
BsuI	GTATCC	1 cut(s)	244
BsuRI	GGCC	2 cut(s)	145, 188
BtgI	CCRYGG	1 cut(s)	394
BtrI	CACGTC	1 cut(s)	43
BtsCI	GGATG	1 cut(s)	163
CciI	TCATGA	1 cut(s)	250
Cfr13I	GGNCC	1 cut(s)	143
CseI	GACGC	1 cut(s)	17
CsiI	ACCWGGT	1 cut(s)	105
Csp6I	GTAC	1 cut(s)	432
CviAII	CATG	5 cut(s)	124, 251, 287, 463, 518
CviJI	RGCY	6 cut(s)	35, 129, 145, 188, 332, 538
CviKI_1	RGCY	6 cut(s)	35, 129, 145, 188, 332, 538
CviQI	GTAC	1 cut(s)	432
DpnI	GATC	5 cut(s)	176, 255, 306, 494, 516
DpnII	GATC	5 cut(s)	174, 253, 304, 492, 514
EaeI	YGGCCR	1 cut(s)	186
Ecl136II	GAGCTC	1 cut(s)	332
Eco24I	GRGCYC	1 cut(s)	334
Eco53kI	GAGCTC	1 cut(s)	332
EcoICRI	GAGCTC	1 cut(s)	332
EcoRI	GAATTC	1 cut(s)	503
EcoRII	CCWGG	1 cut(s)	105
EcoT22I	ATGCAT	1 cut(s)	163
EcoT38I	GRGCYC	1 cut(s)	334
FaeI	CATG	5 cut(s)	127, 254, 290, 466, 521
FatI	CATG	5 cut(s)	123, 250, 286, 462, 517
FbaI	TGATCA	1 cut(s)	174
FokI	GGATG	1 cut(s)	170
FriOI	GRGCYC	1 cut(s)	334
FspBI	CTAG	4 cut(s)	32, 369, 386, 429
GsuI	CTGGAG	1 cut(s)	93
HaeIII	GGCC	2 cut(s)	145, 188
HapII	CCGG	2 cut(s)	100, 146
HgaI	GACGC	1 cut(s)	17
Hin1I	GRCGYC	1 cut(s)	9
Hin1II	CATG	5 cut(s)	127, 254, 290, 466, 521
HinfI	GANTC	1 cut(s)	83
HpaII	CCGG	2 cut(s)	100, 146
HphI	GGTGA	2 cut(s)	163, 348
Hpy166II	GTNNAC	3 cut(s)	16, 325, 391
Hpy188I	TCNGA	6 cut(s)	22, 91, 336, 349, 531, 555
Hpy188III	TCNNGA	4 cut(s)	72, 209, 251, 443
Hpy8I	GTNNAC	3 cut(s)	16, 325, 391
Hpy99I	CGWCG	1 cut(s)	11
HpyAV	CCTTC	1 cut(s)	295
HpyCH4III	ACNGT	1 cut(s)	395
HpyCH4IV	ACGT	1 cut(s)	42
HpyCH4V	TGCA	2 cut(s)	40, 161
HpySE526I	ACGT	1 cut(s)	42
Hsp92I	GRCGYC	1 cut(s)	9
Hsp92II	CATG	5 cut(s)	127, 254, 290, 466, 521
Ksp22I	TGATCA	1 cut(s)	174
Kzo9I	GATC	5 cut(s)	174, 253, 304, 492, 514
LmnI	GCTCC	1 cut(s)	535
LpnPI	CCDG	9 cut(s)	57, 92, 113, 119, 143, 159, 251, 430, 524
LweI	GCATC	3 cut(s)	148, 216, 270
MabI	ACCWGGT	1 cut(s)	105
MaeI	CTAG	4 cut(s)	32, 369, 386, 429
MaeII	ACGT	1 cut(s)	42
MaeIII	GTNAC	1 cut(s)	354
MalI	GATC	5 cut(s)	176, 255, 306, 494, 516
MboI	GATC	5 cut(s)	174, 253, 304, 492, 514
MboII	GAAGA	3 cut(s)	78, 289, 512
MhlI	GDGCHC	1 cut(s)	334
MlsI	TGGCCA	1 cut(s)	188
MluCI	AATT	5 cut(s)	170, 238, 373, 487, 503
MluNI	TGGCCA	1 cut(s)	188
MmeI	TCCRAC	2 cut(s)	453, 463
MnlI	CCTC	2 cut(s)	142, 369
Mox20I	TGGCCA	1 cut(s)	188
Mph1103I	ATGCAT	1 cut(s)	163
MscI	TGGCCA	1 cut(s)	188
MseI	TTAA	3 cut(s)	120, 294, 314
Msp20I	TGGCCA	1 cut(s)	188
MspI	CCGG	2 cut(s)	100, 146
MspR9I	CCNGG	1 cut(s)	107
MvaI	CCWGG	1 cut(s)	107
NdeII	GATC	5 cut(s)	174, 253, 304, 492, 514
NlaIII	CATG	5 cut(s)	127, 254, 290, 466, 521
NlaIV	GGNNCC	1 cut(s)	104
NmuCI	GTSAC	1 cut(s)	354
NsiI	ATGCAT	1 cut(s)	163
NspI	RCATGY	1 cut(s)	466
PagI	TCATGA	1 cut(s)	250
PfeI	GAWTC	1 cut(s)	83
Psp124BI	GAGCTC	1 cut(s)	334
Psp6I	CCWGG	1 cut(s)	105
PspGI	CCWGG	1 cut(s)	105
PspN4I	GGNNCC	1 cut(s)	104
PspPI	GGNCC	1 cut(s)	143
RsaI	GTAC	1 cut(s)	433
RsaNI	GTAC	1 cut(s)	432
SacI	GAGCTC	1 cut(s)	334
SaqAI	TTAA	3 cut(s)	120, 294, 314
Sau3AI	GATC	5 cut(s)	174, 253, 304, 492, 514
Sau96I	GGNCC	1 cut(s)	143
ScaI	AGTACT	1 cut(s)	433
ScrFI	CCNGG	1 cut(s)	107
SduI	GDGCHC	1 cut(s)	334
SetI	ASST	8 cut(s)	33, 37, 45, 108, 153, 334, 361, 540
SexAI	ACCWGGT	1 cut(s)	105
SfaNI	GCATC	3 cut(s)	148, 216, 270
SmlI	CTYRAG	1 cut(s)	443
SmoI	CTYRAG	1 cut(s)	443
SpeI	ACTAGT	2 cut(s)	385, 428
Sse9I	AATT	5 cut(s)	170, 238, 373, 487, 503
SspMI	CTAG	4 cut(s)	32, 369, 386, 429
SstI	GAGCTC	1 cut(s)	334
StyD4I	CCNGG	1 cut(s)	105
TaaI	ACNGT	1 cut(s)	395
TaiI	ACGT	1 cut(s)	45
TasI	AATT	5 cut(s)	170, 238, 373, 487, 503
TatI	WGTACW	1 cut(s)	431
TfiI	GAWTC	1 cut(s)	83
Tru1I	TTAA	3 cut(s)	120, 294, 314
Tru9I	TTAA	3 cut(s)	120, 294, 314
TseFI	GTSAC	1 cut(s)	354
Tsp45I	GTSAC	1 cut(s)	354
TspDTI	ATGAA	1 cut(s)	17
XapI	RAATTY	2 cut(s)	373, 503
XceI	RCATGY	1 cut(s)	466
XspI	CTAG	4 cut(s)	32, 369, 386, 429
ZrmI	AGTACT	1 cut(s)	433
Zsp2I	ATGCAT	1 cut(s)	163

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.