Rmu_co8490289.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8490289.1
Physical Location & Seq
Forward (+)
1 .. 1888
1888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8490289.1_g000001.1.cds

Sequence Viewer

Length: 347 bp
ttttatccctttttctttctttctcaatttcttatgtcttggtttataattctgacttctctacccctcctgcactttcaactgtcaactatttagatggggatgacaaacacactgcgagaaagtattttgcagttcttggaggtgatccaaaacccaagctaaaaaagagaagggctgatagtctcataagccaggagaaaccaggacatgtttatgatcactatgaaaatggttgtggctggtgggactgcaacatggagggtattgacaatgaagaagttggagtcaatgaggtgtgggaaggagtgggctcaaccacattgggaggaatagagtggcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

12.77

Weight (kDa)

4.89

Isoelectric Point (pI)

30.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 47
AclWI GGATC 1 cut(s) 142
AflIII ACRYGT 1 cut(s) 210
AgsI TTSAA 1 cut(s) 80
AjnI CCWGG 2 cut(s) 194, 204
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 190
AlwI GGATC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 157
BanII GRGCYC 1 cut(s) 316
BccI CCATC 1 cut(s) 91
BciT130I CCWGG 2 cut(s) 196, 206
BclI TGATCA 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 190
Bme1390I CCNGG 2 cut(s) 196, 206
BmrFI CCNGG 2 cut(s) 196, 206
BseBI CCWGG 2 cut(s) 196, 206
BseGI GGATG 1 cut(s) 108
BsgI GTGCAG 1 cut(s) 56
BslFI GGGAC 1 cut(s) 262
BsmAI GTCTC 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 262
Bsp1286I GDGCHC 1 cut(s) 316
Bsp143I GATC 2 cut(s) 147, 219
BspPI GGATC 1 cut(s) 142
BssMI GATC 2 cut(s) 147, 219
Bst2UI CCWGG 2 cut(s) 196, 206
Bst4CI ACNGT 1 cut(s) 84
BstF5I GGATG 1 cut(s) 108
BstKTI GATC 2 cut(s) 150, 222
BstMAI GTCTC 1 cut(s) 190
BstMBI GATC 2 cut(s) 147, 219
BstNI CCWGG 2 cut(s) 196, 206
BstNSI RCATGY 1 cut(s) 214
BstSCI CCNGG 2 cut(s) 194, 204
BtsCI GGATG 1 cut(s) 108
BtsI GCAGTG 1 cut(s) 113
BtsIMutI CAGTG 1 cut(s) 113
CviAII CATG 2 cut(s) 211, 258
CviJI RGCY 5 cut(s) 162, 178, 194, 242, 314
CviKI_1 RGCY 5 cut(s) 162, 178, 194, 242, 314
DpnI GATC 2 cut(s) 149, 221
DpnII GATC 2 cut(s) 147, 219
Eco24I GRGCYC 1 cut(s) 316
EcoRII CCWGG 2 cut(s) 194, 204
EcoT38I GRGCYC 1 cut(s) 316
FaeI CATG 2 cut(s) 214, 261
FaiI YATR 7 cut(s) 35, 47, 190, 212, 218, 227, 259
FaqI GGGAC 1 cut(s) 262
FatI CATG 2 cut(s) 210, 257
FbaI TGATCA 1 cut(s) 219
FokI GGATG 1 cut(s) 115
FriOI GRGCYC 1 cut(s) 316
Hin1II CATG 2 cut(s) 214, 261
HincII GTYRAC 1 cut(s) 87
HindII GTYRAC 1 cut(s) 87
HinfI GANTC 1 cut(s) 287
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 87
Hpy188I TCNGA 1 cut(s) 54
Hpy8I GTNNAC 1 cut(s) 87
HpyAV CCTTC 2 cut(s) 167, 298
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 3 cut(s) 73, 133, 254
Hsp92II CATG 2 cut(s) 214, 261
Ksp22I TGATCA 1 cut(s) 219
Kzo9I GATC 2 cut(s) 147, 219
LpnPI CCDG 6 cut(s) 83, 181, 191, 208, 218, 228
MalI GATC 2 cut(s) 149, 221
MboI GATC 2 cut(s) 147, 219
MboII GAAGA 1 cut(s) 289
MhlI GDGCHC 1 cut(s) 316
MluCI AATT 2 cut(s) 26, 48
MlyI GAGTC 1 cut(s) 296
MmeI TCCRAC 1 cut(s) 264
MnlI CCTC 5 cut(s) 77, 136, 255, 288, 322
MslI CAYNNNNRTG 1 cut(s) 215
MspR9I CCNGG 2 cut(s) 196, 206
MvaI CCWGG 2 cut(s) 196, 206
NdeII GATC 2 cut(s) 147, 219
NlaIII CATG 2 cut(s) 214, 261
NspI RCATGY 1 cut(s) 214
PciI ACATGT 1 cut(s) 210
PleI GAGTC 1 cut(s) 295
PpsI GAGTC 1 cut(s) 295
PscI ACATGT 1 cut(s) 210
PsiI TTATAA 1 cut(s) 47
Psp6I CCWGG 2 cut(s) 194, 204
PspGI CCWGG 2 cut(s) 194, 204
RseI CAYNNNNRTG 1 cut(s) 215
Sau3AI GATC 2 cut(s) 147, 219
SchI GAGTC 1 cut(s) 296
ScrFI CCNGG 2 cut(s) 196, 206
SduI GDGCHC 1 cut(s) 316
SetI ASST 3 cut(s) 147, 164, 299
SmiMI CAYNNNNRTG 1 cut(s) 215
Sse9I AATT 2 cut(s) 26, 48
StyD4I CCNGG 2 cut(s) 194, 204
TaaI ACNGT 1 cut(s) 84
TasI AATT 2 cut(s) 26, 48
TscAI CASTG 1 cut(s) 120
TspDTI ATGAA 2 cut(s) 242, 290
TspRI CASTG 1 cut(s) 120
XceI RCATGY 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.