Rmu_sc0008728.1_g000011

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008728.1
Physical Location & Seq
Reverse (-)
83605 .. 84064
460 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008728.1_g000011.1.cds

Sequence Viewer

Length: 318 bp
atgtctttggtttataattctgacttctctacccctcctgctctttcaaatgtcaactatttagatggggatgacaaacacactgcgagaaagtattttgcagttcttggaggtgaaccaaaacccaagctaaaaaagagaagggctgagagtctcataagccaagagaaaccaggacatgtttatgatcactatgaaaatggttgtggctggtgggactgcaatatggagggtattattgacaatgaagaagttggtgtcaatgatgtgtgggaaggattgggctcaaccacattgggaggaatagagtggcgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.8

Weight (kDa)

4.92

Isoelectric Point (pI)

37.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 15
AflIII ACRYGT 1 cut(s) 178
AgsI TTSAA 1 cut(s) 48
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 125
BanII GRGCYC 1 cut(s) 287
BccI CCATC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 174
BclI TGATCA 1 cut(s) 187
BcoDI GTCTC 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 138
BslFI GGGAC 1 cut(s) 230
BsmAI GTCTC 1 cut(s) 158
BsmFI GGGAC 1 cut(s) 230
Bsp1286I GDGCHC 1 cut(s) 287
Bsp143I GATC 1 cut(s) 187
BspCNI CTCAG 1 cut(s) 139
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 1 cut(s) 187
BstNI CCWGG 1 cut(s) 174
BstNSI RCATGY 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 172
BtsCI GGATG 1 cut(s) 76
BtsI GCAGTG 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 81
CviAII CATG 1 cut(s) 179
CviJI RGCY 5 cut(s) 130, 146, 162, 210, 285
CviKI_1 RGCY 5 cut(s) 130, 146, 162, 210, 285
DdeI CTNAG 1 cut(s) 147
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco24I GRGCYC 1 cut(s) 287
EcoRII CCWGG 1 cut(s) 172
EcoT38I GRGCYC 1 cut(s) 287
FaeI CATG 1 cut(s) 182
FaiI YATR 6 cut(s) 15, 158, 180, 186, 195, 227
FaqI GGGAC 1 cut(s) 230
FatI CATG 1 cut(s) 178
FbaI TGATCA 1 cut(s) 187
FokI GGATG 1 cut(s) 83
FriOI GRGCYC 1 cut(s) 287
Hin1II CATG 1 cut(s) 182
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 1 cut(s) 151
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 2 cut(s) 55, 116
Hpy188I TCNGA 1 cut(s) 22
Hpy8I GTNNAC 2 cut(s) 55, 116
HpyAV CCTTC 2 cut(s) 135, 269
HpyCH4V TGCA 2 cut(s) 101, 222
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 1 cut(s) 182
Ksp22I TGATCA 1 cut(s) 187
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 4 cut(s) 51, 159, 186, 196
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 1 cut(s) 260
MhlI GDGCHC 1 cut(s) 287
MluCI AATT 1 cut(s) 16
MlyI GAGTC 1 cut(s) 160
MnlI CCTC 4 cut(s) 45, 104, 223, 293
MslI CAYNNNNRTG 1 cut(s) 183
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NdeII GATC 1 cut(s) 187
NlaIII CATG 1 cut(s) 182
NspI RCATGY 1 cut(s) 182
PciI ACATGT 1 cut(s) 178
PleI GAGTC 1 cut(s) 159
PpsI GAGTC 1 cut(s) 159
PscI ACATGT 1 cut(s) 178
PsiI TTATAA 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 183
Sau3AI GATC 1 cut(s) 187
SchI GAGTC 1 cut(s) 160
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 287
SetI ASST 2 cut(s) 115, 132
SgeI CNNG 9 cut(s) 50, 99, 119, 139, 176, 185, 186, 191, 223
SmiMI CAYNNNNRTG 1 cut(s) 183
Sse9I AATT 1 cut(s) 16
StyD4I CCNGG 1 cut(s) 172
TasI AATT 1 cut(s) 16
TscAI CASTG 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 210, 261
TspRI CASTG 1 cut(s) 88
XceI RCATGY 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.