Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000147.1

Orthogroup ID

OG0007530

Physical Location & Seq

Genomic Coordinates Reverse (-)

410402 .. 411267

Gene Structure 866 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000147.1_g000093.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 741 bp

atggctgccttgttcgccaagttttgttctcaagctgtcattattttccttctcattgtcccttccttggtttccaagtcatgtgctgcatgcattgtggtttactggggccaaaatgaaggtgaagcatccaatggctgccaaggcatcagcaagggagttcgaaactgccaaaacgaagggattaaggtcctgatttcaattggtggttccaatgggagctacacactgtcagatgcagatgatgccaggcgtgtagcagactacatatggaataacttcttaggggggaaatcaaactcaaggcctttaggcgatgctgttttagatggtgtggatttcgacattgagaagggcgaacctcactatgctgcactggctaggaagttatccgagtatagcgcaagtagccaaaaagtgttattatctgcagcaccacaatgcccattttctgaccagaaactcaatggtgcattaactacaggcctatttgactatgtttgggttcaattctacaacaacccacaatgtgaatatatctctagcaattttgatgccttcaagaactcatggaaccaatggaacaccatagacgctagattgttctttgtcgggcttccagcttcacatgcagctgctggcagtgggtatgtgccttcaaatgatatgataaaccaggtgtcatgctttatgataggtatgaagataaatcaaattaatggctcactatatgtaaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

Glyco_hydro_18

Protein Analysis

246

Amino Acids

26.69

Weight (kDa)

5.67

Isoelectric Point (pI)

24.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007530)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g15680
prunus_persica	Prupe.2G181400_v2.0.a1 Prupe.2G181500_v2.0.a1 Prupe.2G181600_v2.0.a1
pyrus_communis	pycom07g12500 pycom07g12560 pycom07g12610 pycom13g15500 pycom15g35750
rosa_chinensis	RchiOBHm_Chr1g0358401 RchiOBHm_Chr1g0358411
rosa_laevigata	RLG00000027962 RLG00000027963
rosa_multiflora	Rmu_sc0000147.1_g000093 Rmu_sc0002144.1_g000033
rosa_roxburghii	Rroxscaffold_4G00297990
rosa_rugosa	Rorug01G0261500
rosa_samantha	Rh1AG275800 Rh1AG276100 Rh1BG242400 Rh1BG242600 Rh1CG259000 Rh1CG259600
rosa_wichuraiana	Rw1G024540 Rw1G024560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AdeI	CACNNNGTG	1 cut(s)	530
AfiI	CCNNNNNNNGG	1 cut(s)	67
AgsI	TTSAA	4 cut(s)	201, 509, 562, 660
AjnI	CCWGG	2 cut(s)	248, 675
AluBI	AGCT	4 cut(s)	35, 222, 623, 635
AluI	AGCT	4 cut(s)	35, 222, 623, 635
AlwNI	CAGNNNCTG	1 cut(s)	638
AoxI	GGCC	3 cut(s)	109, 305, 484
ApeKI	GCWGC	7 cut(s)	5, 86, 138, 371, 431, 632, 635
AseI	ATTAAT	1 cut(s)	717
Asp700I	GAANNNNTTC	1 cut(s)	278
AspLEI	GCGC	1 cut(s)	404
AspS9I	GGNCC	2 cut(s)	109, 190
AsuHPI	GGTGA	1 cut(s)	134
AsuII	TTCGAA	1 cut(s)	163
AvaII	GGWCC	1 cut(s)	190
BbvI	GCAGC	6 cut(s)	73, 125, 358, 443, 622, 644
BccI	CCATC	1 cut(s)	323
BciT130I	CCWGG	2 cut(s)	250, 677
BfaI	CTAG	3 cut(s)	381, 543, 597
BfmI	CTRYAG	2 cut(s)	429, 480
BisI	GCNGC	7 cut(s)	6, 87, 139, 372, 432, 633, 636
BlsI	GCNGC	7 cut(s)	7, 88, 140, 373, 433, 634, 637
Bme1390I	CCNGG	2 cut(s)	250, 677
Bme18I	GGWCC	1 cut(s)	190
BmgT120I	GGNCC	2 cut(s)	109, 190
BmiI	GGNNCC	3 cut(s)	110, 211, 575
BmrFI	CCNGG	2 cut(s)	250, 677
BmrI	ACTGGG	1 cut(s)	115
BmsI	GCATC	6 cut(s)	137, 156, 226, 235, 307, 544
BmuI	ACTGGG	1 cut(s)	115
Bpu14I	TTCGAA	1 cut(s)	163
BpuEI	CTTGAG	2 cut(s)	15, 286
BsaJI	CCNNGG	2 cut(s)	66, 142
Bsc4I	CCNNNNNNNGG	1 cut(s)	67
Bse1I	ACTGG	2 cut(s)	110, 381
BseBI	CCWGG	2 cut(s)	250, 677
BseDI	CCNNGG	2 cut(s)	66, 142
BseGI	GGATG	1 cut(s)	128
BseLI	CCNNNNNNNGG	1 cut(s)	67
BseNI	ACTGG	2 cut(s)	110, 381
BseXI	GCAGC	6 cut(s)	73, 125, 358, 443, 622, 644
BsgI	GTGCAG	1 cut(s)	357
BshFI	GGCC	3 cut(s)	111, 307, 486
BslFI	GGGAC	1 cut(s)	44
BslI	CCNNNNNNNGG	1 cut(s)	67
BsmFI	GGGAC	1 cut(s)	44
BsnI	GGCC	3 cut(s)	111, 307, 486
Bsp119I	TTCGAA	1 cut(s)	163
BspANI	GGCC	3 cut(s)	111, 307, 486
BspLI	GGNNCC	3 cut(s)	110, 211, 575
BspMAI	CTGCAG	1 cut(s)	433
BspT104I	TTCGAA	1 cut(s)	163
BsrI	ACTGG	2 cut(s)	110, 381
BssECI	CCNNGG	2 cut(s)	66, 142
BssT1I	CCWWGG	2 cut(s)	66, 142
Bst2UI	CCWGG	2 cut(s)	250, 677
Bst4CI	ACNGT	1 cut(s)	231
BstAPI	GCANNNNNTGC	1 cut(s)	245
BstBI	TTCGAA	1 cut(s)	163
BstC8I	GCNNGC	2 cut(s)	91, 640
BstDEI	CTNAG	1 cut(s)	283
BstF5I	GGATG	1 cut(s)	128
BstHHI	GCGC	1 cut(s)	404
BstMWI	GCNNNNNNNGC	6 cut(s)	14, 144, 245, 377, 408, 629
BstNI	CCWGG	2 cut(s)	250, 677
BstNSI	RCATGY	2 cut(s)	93, 632
BstSCI	CCNGG	2 cut(s)	248, 675
BstSFI	CTRYAG	2 cut(s)	429, 480
BstV1I	GCAGC	6 cut(s)	73, 125, 358, 443, 622, 644
BsuRI	GGCC	3 cut(s)	111, 307, 486
BtgZI	GCGATG	1 cut(s)	330
BtsCI	GGATG	1 cut(s)	128
BtsI	GCAGTG	1 cut(s)	649
BtsIMutI	CAGTG	3 cut(s)	227, 374, 649
Cac8I	GCNNGC	2 cut(s)	91, 640
CaiI	CAGNNNCTG	1 cut(s)	638
CfoI	GCGC	1 cut(s)	404
Cfr13I	GGNCC	2 cut(s)	109, 190
CseI	GACGC	1 cut(s)	602
CsiI	ACCWGGT	1 cut(s)	675
CviAII	CATG	5 cut(s)	81, 90, 570, 629, 684
DdeI	CTNAG	1 cut(s)	283
DraIII	CACNNNGTG	1 cut(s)	530
Eco130I	CCWWGG	2 cut(s)	66, 142
Eco147I	AGGCCT	2 cut(s)	307, 486
Eco47I	GGWCC	1 cut(s)	190
EcoO109I	RGGNCCY	1 cut(s)	190
EcoRII	CCWGG	2 cut(s)	248, 675
EcoT14I	CCWWGG	2 cut(s)	66, 142
EcoT22I	ATGCAT	1 cut(s)	95
ErhI	CCWWGG	2 cut(s)	66, 142
FaeI	CATG	5 cut(s)	84, 93, 573, 632, 687
FaqI	GGGAC	1 cut(s)	44
FatI	CATG	5 cut(s)	80, 89, 569, 628, 683
FauNDI	CATATG	1 cut(s)	269
Fnu4HI	GCNGC	7 cut(s)	6, 87, 139, 372, 432, 633, 636
FokI	GGATG	1 cut(s)	115
Fsp4HI	GCNGC	7 cut(s)	6, 87, 139, 372, 432, 633, 636
FspBI	CTAG	3 cut(s)	381, 543, 597
GlaI	GCGC	1 cut(s)	403
GluI	GCNGC	7 cut(s)	6, 87, 139, 372, 432, 633, 636
HaeIII	GGCC	3 cut(s)	111, 307, 486
HgaI	GACGC	1 cut(s)	602
HhaI	GCGC	1 cut(s)	404
Hin1II	CATG	5 cut(s)	84, 93, 573, 632, 687
Hin6I	GCGC	1 cut(s)	402
HinP1I	GCGC	1 cut(s)	402
HphI	GGTGA	1 cut(s)	134
Hpy166II	GTNNAC	1 cut(s)	103
Hpy188I	TCNGA	3 cut(s)	235, 394, 454
Hpy188III	TCNNGA	2 cut(s)	193, 562
Hpy8I	GTNNAC	1 cut(s)	103
HpyAV	CCTTC	7 cut(s)	59, 72, 113, 173, 346, 568, 666
HpyCH4III	ACNGT	1 cut(s)	231
HpyCH4V	TGCA	7 cut(s)	89, 93, 239, 374, 431, 473, 632
HpyF10VI	GCNNNNNNNGC	6 cut(s)	14, 144, 245, 377, 408, 629
HpyF3I	CTNAG	1 cut(s)	283
Hsp92II	CATG	5 cut(s)	84, 93, 573, 632, 687
HspAI	GCGC	1 cut(s)	402
LmnI	GCTCC	1 cut(s)	219
Lsp1109I	GCAGC	6 cut(s)	73, 125, 358, 443, 622, 644
LweI	GCATC	6 cut(s)	137, 156, 226, 235, 307, 544
MabI	ACCWGGT	1 cut(s)	675
MaeI	CTAG	3 cut(s)	381, 543, 597
MboII	GAAGA	1 cut(s)	715
MfeI	CAATTG	1 cut(s)	201
MluCI	AATT	4 cut(s)	201, 509, 547, 714
MnlI	CCTC	1 cut(s)	372
Mph1103I	ATGCAT	1 cut(s)	95
MroXI	GAANNNNTTC	1 cut(s)	278
MseI	TTAA	3 cut(s)	186, 476, 717
MslI	CAYNNNNRTG	1 cut(s)	439
MspA1I	CMGCKG	1 cut(s)	635
MspR9I	CCNGG	2 cut(s)	250, 677
MunI	CAATTG	1 cut(s)	201
MvaI	CCWGG	2 cut(s)	250, 677
MwoI	GCNNNNNNNGC	6 cut(s)	14, 144, 245, 377, 408, 629
NdeI	CATATG	1 cut(s)	269
NlaIII	CATG	5 cut(s)	84, 93, 573, 632, 687
NlaIV	GGNNCC	3 cut(s)	110, 211, 575
NsiI	ATGCAT	1 cut(s)	95
NspI	RCATGY	2 cut(s)	93, 632
NspV	TTCGAA	1 cut(s)	163
PaeI	GCATGC	1 cut(s)	93
PceI	AGGCCT	2 cut(s)	307, 486
PdmI	GAANNNNTTC	1 cut(s)	278
PkrI	GCNGC	7 cut(s)	7, 88, 140, 373, 433, 634, 637
PpuMI	RGGWCCY	1 cut(s)	190
PshBI	ATTAAT	1 cut(s)	717
Psp5II	RGGWCCY	1 cut(s)	190
Psp6I	CCWGG	2 cut(s)	248, 675
PspGI	CCWGG	2 cut(s)	248, 675
PspN4I	GGNNCC	3 cut(s)	110, 211, 575
PspPI	GGNCC	2 cut(s)	109, 190
PspPPI	RGGWCCY	1 cut(s)	190
PstI	CTGCAG	1 cut(s)	433
PstNI	CAGNNNCTG	1 cut(s)	638
PvuII	CAGCTG	1 cut(s)	635
RseI	CAYNNNNRTG	1 cut(s)	439
SaqAI	TTAA	3 cut(s)	186, 476, 717
SatI	GCNGC	7 cut(s)	6, 87, 139, 372, 432, 633, 636
Sau96I	GGNCC	2 cut(s)	109, 190
ScrFI	CCNGG	2 cut(s)	250, 677
SetI	ASST	9 cut(s)	37, 124, 192, 224, 364, 625, 637, 681, 700
SexAI	ACCWGGT	1 cut(s)	675
SfaNI	GCATC	6 cut(s)	137, 156, 226, 235, 307, 544
SfcI	CTRYAG	2 cut(s)	429, 480
SfuI	TTCGAA	1 cut(s)	163
SinI	GGWCC	1 cut(s)	190
SmiMI	CAYNNNNRTG	1 cut(s)	439
SmlI	CTYRAG	2 cut(s)	30, 301
SmoI	CTYRAG	2 cut(s)	30, 301
SphI	GCATGC	1 cut(s)	93
Sse9I	AATT	4 cut(s)	201, 509, 547, 714
SseBI	AGGCCT	2 cut(s)	307, 486
SspMI	CTAG	3 cut(s)	381, 543, 597
StuI	AGGCCT	2 cut(s)	307, 486
StyD4I	CCNGG	2 cut(s)	248, 675
StyI	CCWWGG	2 cut(s)	66, 142
TaaI	ACNGT	1 cut(s)	231
TaqI	TCGA	2 cut(s)	163, 342
TasI	AATT	4 cut(s)	201, 509, 547, 714
Tru1I	TTAA	3 cut(s)	186, 476, 717
Tru9I	TTAA	3 cut(s)	186, 476, 717
TscAI	CASTG	3 cut(s)	234, 381, 649
TseI	GCWGC	7 cut(s)	5, 86, 138, 371, 431, 632, 635
TspDTI	ATGAA	2 cut(s)	132, 716
TspRI	CASTG	3 cut(s)	234, 381, 649
VpaK11BI	GGWCC	1 cut(s)	190
VspI	ATTAAT	1 cut(s)	717
XceI	RCATGY	2 cut(s)	93, 632
XcmI	CCANNNNNNNNNTGG	1 cut(s)	464
XmnI	GAANNNNTTC	1 cut(s)	278
XspI	CTAG	3 cut(s)	381, 543, 597
Zsp2I	ATGCAT	1 cut(s)	95

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.